KIAA0409

Product ID	ORK00068
Accession No	AB007869
Description	ribosomal RNA processing 8, methyltransferase, homolog (yeast)
Clone name	hg01499
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6469 bp) Predicted protein sequence (464 aa)
HaloTag ORF Clone	FHC00068
Flexi ORF Clone	FXC00068
Source	Human adult brain
Rouge ID	mKIAA0409 by Kazusa Mouse cDNA Project

Length: 6469 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	5074 bp
Genome contig ID	gi51511727r_6473043
PolyA signal sequence (AATAAA,-12)	+--------+--------+----*----+---- CTGAGATCCTGTCTCAATAAATAAATAAAACAATT
Flanking genome sequence (99838 - 99789)	----+--------+--------+--------+--------+----* ATATATATGTATAATATATAATATTATATATACATATGTATGTATGATGC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	11	r	6572881	6581332	7	99.2	Perfect prediction

Length: 464 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001100895	4.2e-153	93.5	similar to T07A...	Macaca mulatta
XP_534039	2.5e-128	81.3	similar to T07A...	Canis lupus fam...
BAE42874	1.3e-118	76.6	unnamed protein...	Mus musculus
BAE41665	2.4e-118	76.4	unnamed protein...	Mus musculus
Q9DB85	2.4e-117	76.0	Cerebral protei...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007823	245	464	PF05148	Methyltransferases-related
ScanRegExp	IPR004033	388	402	PS01184	UbiE/COQ5 methyltransferase

Primer_f	AGGAGCTGTGGGCAATTAAGG
Primer_r	TTGGCATTGGTTCTGGAGCTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	AGGAGCTGTGGGCAATTAAGG
Primer_r	TTGGCATTGGTTCTGGAGCTG
PCR product length	153 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles