KIAA0410

Product ID	ORK00529
Accession No	AB007870
Description	nucleoporin like 1
Clone name	hg01877
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6356 bp) Predicted protein sequence (505 aa)
HaloTag ORF Clone	FHC00529
Flexi ORF Clone	FXC00529
Source	Human adult brain
Rouge ID	mKIAA0410 by Kazusa Mouse cDNA Project

Length: 6356 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	4755 bp
Genome contig ID	gi51511729f_24673769
PolyA signal sequence (AATAAA,-8)	+--------+--------+----*----+---- ATTTGCTTTACAATGAACAATAAATTTAATAAAAT
Flanking genome sequence (134711 - 134760)	----+--------+--------+--------+--------+----* AAAACATTGTCTTGTTTTTTATCTACTTATTGTATATATCATTTATATTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	13	f	24773769	24808478	13	99.2	Perfect prediction

Length: 505 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAI39901	4.3e-146	100.0	nucleoporin lik...	Homo sapiens
EAX08370	1.6e-145	99.6	nucleoporin lik...	Homo sapiens
NP_001008565	3.1e-144	100.0	nucleoporin lik...	Homo sapiens
Q9BVL2	3.5e-144	100.0	Nucleoporin p58...	Homo sapiens
EAX08368	1.2e-143	99.6	nucleoporin lik...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB029037	0.00068	32.2	KIAA1114
AB014518	0.001	29.1	KIAA0618

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Primer_f	ACATTTACAAAGGCACCGCTG
Primer_r	TGACTAATCGTTCTGCTTCTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CATTACACCACTTATCACCTG
Primer_r	AATCGTTCTGCTTCTGAGTAC
PCR product length	115 bp
PCR conditions	95 °C15 sec60 °C60 sec30 cycles