KIAA0432

Product ID	ORK04510
Accession No	AB007892
Description	cell division cycle 5-like
Clone name	hh01859s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6201 bp) Predicted protein sequence (827 aa)
Source	Human adult brain
Rouge ID	mKIAA0432 by Kazusa Mouse cDNA Project
Note	We replaced hh01859, former representative clones for KIAA0432 with hh01859s1. (2002/5/10)

Length: 6201 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	3710 bp
Genome contig ID	gi89161210f_44363457
PolyA signal sequence (ATTAAA,-23)	+--------+--------+----*----+---- AAGCAACTTTAAATTAAAAAAATTGTTTTTAAAAT
Flanking genome sequence (162684 - 162733)	----+--------+--------+--------+--------+----* ATATTCTTCCTTTTATGTTTATTTAGTAAATTTAGGTAATGTATACTTTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	6	f	44463457	44526139	16	99.3	Perfect prediction

Length: 827 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_532156	98.4	similar to CDC5...	Canis lupus fam...
Q99459	100.0	Cell division c...	Homo sapiens
XP_001100220	99.8	similar to CDC5...	Macaca mulatta
BAG54722	99.9	unnamed protein...	Homo sapiens
XP_001502528	98.9	similar to CDC5...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR014778	33	79	PF00249	Myb
HMMPfam	IPR014778	85	129	PF00249	Myb
HMMSmart	IPR001005	32	81	SM00717	SANT
HMMSmart	IPR001005	84	131	SM00717	SANT
ProfileScan	IPR001005	28	79	PS50090	SANT
ProfileScan	IPR001005	80	129	PS50090	SANT
ScanRegExp	IPR001005	88	96	PS00037	SANT
ScanRegExp	IPR001005	107	129	PS00334	SANT

Primer_f	GATAAAGCTGCCCAAAGAGAC
Primer_r	CATCTCAAGTTCATCCTCATC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GTGACTGCAGACTTAATGTTG
Primer_r	CAATAGCCCAAAAGACCAATC
PCR product length	127 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles