KIAA0440

Product ID	ORK01667
Accession No	AB007900
Description	signal-induced proliferation-associated 1 like 1, transcript variant 1
Clone name	ah05029
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5737 bp) Predicted protein sequence (1817 aa)
HaloTag ORF Clone	FHC01667
Flexi ORF Clone	FXC01667
Source	Human brain (amygdala)
Rouge ID	mKIAA0440 by Kazusa Mouse cDNA Project
Note	We replaced hh00452, former representative clones for KIAA0440 with ah05029. (2002/5/10)

Length: 5737 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	240 bp
Genome contig ID	gi51511730f_71024258
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- AAAATTTTAAACAGTAAAATAAAAGTTTAACTGCT
Flanking genome sequence (251615 - 251664)	----+--------+--------+--------+--------+----* AAAATGTGAATGTCTTTATTTTTTTGCACAATATCTTTATCTGTTATGTA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	14	f	71124258	71275871	21	99.7	Perfect prediction

Length: 1817 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI46778	100.0	SIPA1L1 protein...	Homo sapiens
O43166	99.9	Signal-induced ...	Homo sapiens
XP_510040	99.7	signal-induced ...	Pan troglodytes
XP_001084201	99.4	similar to sign...	Macaca mulatta
XP_001488355	97.2	similar to high...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037810	3.8e-138	54.3	KIAA1389
AB011117	2.5e-108	51.2	KIAA0545
AB007943	4.1e-20	39.8	KIAA0474
AB028962	1.9e-17	50.0	KIAA1039
AB033098	0.00017	28.7	KIAA1272

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000331	642	830	PF02145	Rap/ran-GAP
HMMPfam	IPR001478	967	1039	PF00595	PDZ/DHR/GLGF
HMMSmart	IPR001478	976	1042	SM00228	PDZ/DHR/GLGF
ProfileScan	IPR000331	613	830	PS50085	Rap/ran-GAP
ProfileScan	IPR001478	967	1031	PS50106	PDZ/DHR/GLGF

Primer_f	CCCAAGTCCCCAAACAAAATG
Primer_r	ACATCCAAGCATTCTGAAGTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CCCAAGTCCCCAAACAAAATG
Primer_r	ACATCCAAGCATTCTGAAGTC
PCR product length	80 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles