Order Kazusa clone(s) from : ![]() |
Product ID | ORK06832 |
---|---|
Accession No | AB011117 |
Description | signal-induced proliferation-associated 1 like 3 |
Clone name | hh00165s1 |
Vector information | |
cDNA sequence | DNA sequence (6237 bp) Predicted protein sequence (1368 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA0545
by Kazusa Mouse cDNA Project
|
Note | We replaced hh00165, former representative clones for KIAA0545 with hh00165s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 2129 bp |
---|---|
Genome contig ID | gi42406306f_43165284 |
PolyA signal sequence (AATAAA,-16) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (225564 - 225613) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 19 | f | 43265284 | 43390846 | 20 | 99.6 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
---|
Primer_f | CAGTTGTCTCCTCCCATCTTC |
---|---|
Primer_r | GCTGCTATCTTCGGCCATTGG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CAGTTGTCTCCTCCCATCTTC |
Primer_r | GCTGCTATCTTCGGCCATTGG |
PCR product length | 177 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |