Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK04369 |
---|---|
Accession No | AB033098 |
Description | Ral GTPase activating protein, alpha subunit 2 (catalytic) |
Clone name | hk07611 |
Vector information | |
cDNA sequence | DNA sequence (3902 bp) Predicted protein sequence (1023 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA1272
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000331 | 852 | 1016 | PF02145 | Rap/ran-GAP |
ProfileScan | IPR000331 | 823 | 1023 | PS50085 | Rap/ran-GAP |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 343 | EYARCIAVCSLGVWICEELAQCT | 365 | SECONDARY | 23 | 2 | 385 | NKIVAQVACDVLQLLVSYWEKLQ | 407 | SECONDARY | 23 | 3 | 445 | VSLLLCLLDWCMALPVSVLLHPV | 467 | PRIMARY | 23 |
---|
RT-PCR-ELISA |
Primer_f | GCCCTAGCATTTATTGGACCA |
---|---|
Primer_r | CAGTAATGTGTTGGCAGTGCG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | GCCCTAGCATTTATTGGACCA |
Primer_r | CAGTAATGTGTTGGCAGTGCG |
PCR product length | 148 bp |
PCR conditions | 95 °C15 sec64 °C60 sec30 cycles |