KIAA0442

Product ID	ORK04237
Accession No	AB007902
Description	autism susceptibility candidate 2
Clone name	hh03913
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. This cDNA clone hh03913 has an irregular adapter sequence (GTCGACCCAC GCGTCCGCGG ACGCGGGGG) instead of regular one (GTCGACCCAC GCGTCCG).
cDNA sequence	DNA sequence (5495 bp) Predicted protein sequence (1266 aa)
Source	Human adult brain
Rouge ID	mKIAA0442 by Kazusa Mouse cDNA Project
Note	We replaced hh00712, former representative clones for KIAA0442 with hh03913. (2002/5/10)

Length: 5495 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1491 bp
Genome contig ID	gi89161213f_68602280
PolyA signal sequence (None)	+--------+--------+----*----+---- TAAAGTGCTATCTGACGTTGTTATCCTGTTTTTGC
Flanking genome sequence (1293131 - 1293180)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAGTTAACTACAGACCATTGTTTCTAATAAGC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	7	f	68702280	69895409	16	100.0	Internal No-hit

Length: 1266 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAH64693	0	99.9	AUTS2 protein [...	Homo sapiens
EDL19458	7.7e-216	86.7	mCG121910, isof...	Mus musculus
Q8WXX7	7.5e-176	98.0	Autism suscepti...	Homo sapiens
AAS07468	1.6e-175	97.6	unknown [Homo s...	Homo sapiens
XP_001089340	3.9e-175	96.7	similar to auti...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB046765	2.7e-12	38.6	KIAA1545
AB007927	0.00075	23.9	KIAA0458

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	NULL	659	865	PD360677	NULL

Primer_f	GGAAGAAGAAACCCTAGGCAG
Primer_r	ATGACTGGGCTAAAAGATCTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CATTACACAAGAAGGCTCCGC
Primer_r	GTTCTATACGGACCTTTTTGC
PCR product length	128 bp
PCR conditions	95 °C15 sec64 °C60 sec32 cycles