KIAA1545

Product ID	ORK04238
Accession No	AB046765
Description	fibrosin-like 1
Clone name	fj14026s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4307 bp) Predicted protein sequence (968 aa)
Source	Human fetal brain
Rouge ID	mKIAA1545 by Kazusa Mouse cDNA Project
Note	We replaced fj14026, former representative clones for KIAA1545 with fj14026s1. (2002/5/10)

Length: 4307 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1398 bp
Genome contig ID	gi89161190f_131477459
PolyA signal sequence (GATAAA,-25)	+--------+--------+----*----+---- AATCAGTGACGATAAATACAGCCTTGATTTGGATG
Flanking genome sequence (194387 - 194436)	----+--------+--------+--------+--------+----* AAACTGTGGTCGCGTGTTCTGTGGTGTTGGGGGGCCAGGCTCACCCAGGC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	12	f	131577459	131671844	17	99.5	Perfect prediction

Length: 968 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9HCM7	0	99.9	AUTS2-like prot...	Homo sapiens
NP_001136113	0	99.9	fibrosin-like 1...	Homo sapiens
AAO85466	2.9e-201	99.8	XTP9 [Homo sapi...	Homo sapiens
XP_001253535	4.5e-60	60.8	similar to RIKE...	Bos taurus
XP_001378040	1.3e-59	45.9	similar to auti...	Monodelphis dom...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB007902	4e-14	38.4	KIAA0442

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	NULL	517	717	PD360677	NULL

Primer_f	TCGGCTTTTCTGAGGGTGATC
Primer_r	TGCAAATCCCAACCGAAAACG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-