KIAA0451

Product ID	ORK04505
Accession No	AB007920
Description	CDC42 binding protein kinase alpha (DMPK-like)
Clone name	pf06424
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (7335 bp) Predicted protein sequence (983 aa)
Source	Human brain (hippocampus)
Rouge ID	mKIAA0451 by Kazusa Mouse cDNA Project
Note	We replaced hg00286, former representative clones for KIAA0451 with pf06424. (2003/8/28)

Length: 7335 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	4382 bp
Genome contig ID	gi89161185r_225144190
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- GACTTTGCTGTATTGCAATAAAACAGAGAACTGTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGCATTGAGTATTTTGTCTCTTTTCCCCCCACTTGAAAGTCTGAGAAATA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	r	225244190	225335303	22	99.3	Perfect prediction

Length: 983 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAI19112	99.8	CDC42 binding p...	Homo sapiens
XP_001088134	98.9	similar to CDC4...	Macaca mulatta
XP_863624	96.3	similar to CDC4...	Canis lupus fam...
CAH71184	93.5	CDC42 binding p...	Homo sapiens
CAH71183	93.5	CDC42 binding p...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB032950	9.6e-93	52.1	KIAA1124
AB023166	0.00012	21.8	KIAA0949

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002219	199	213	PR00008	Protein kinase C
	IPR002219	215	224	PR00008	Protein kinase C
	IPR002219	228	239	PR00008	Protein kinase C
	IPR002219	240	252	PR00008	Protein kinase C
HMMPfam	IPR014930	83	143	PF08826	DMPK coiled coil
	IPR002219	202	254	PF00130	Protein kinase C
	IPR001849	272	390	PF00169	Pleckstrin-like
	IPR001180	417	688	PF00780	Citron-like
HMMSmart	IPR002219	202	251	SM00109	Protein kinase C
	IPR001849	272	392	SM00233	Pleckstrin-like
	IPR001180	417	699	SM00036	Citron-like
	IPR000095	760	795	SM00285	PAK-box/P21-Rho-binding
	IPR000095	801	838	SM00285	PAK-box/P21-Rho-binding
ProfileScan	IPR002219	201	251	PS50081	Protein kinase C
	IPR001849	271	390	PS50003	Pleckstrin-like
	IPR000095	760	773	PS50108	PAK-box/P21-Rho-binding
	IPR000095	801	814	PS50108	PAK-box/P21-Rho-binding
ScanRegExp	IPR002219	202	251	PS00479	Protein kinase C
ScanRegExp	IPR001304	218	239	PS00615	C-type lectin

Primer_f
Primer_r
PCR conditions	°C sec °C sec cycles

Panel name	GeneBridge 4
Primer_f	ATTGGTGAGGAGTCTTTTGTG
Primer_r	TTTATGCCCTCAGTGTCTTAG
PCR product length	128 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles