KIAA1124

Product ID	ORK00181
Accession No	AB032950
Description	CDC42 binding protein kinase beta (DMPK-like)
Clone name	fg05708
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. This cDNA clone fg05708 has an irregular adapter sequence (GTCGACCCAC GCGTCCGCGG ACGCGTGGG) instead of regular one (GTCGACCCAC GCGTCCG).
cDNA sequence	DNA sequence (6678 bp) Predicted protein sequence (1760 aa)
HaloTag ORF Clone	FHC00181
Flexi ORF Clone	FXC00181
Source	Human fetal brain
Rouge ID	mKIAA1124 by Kazusa Mouse cDNA Project
Note	We replaced hj05161, former representative clones for KIAA1124 with fg05708. (2001/5/29)

Length: 6678 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1319 bp
Genome contig ID	gi51511730r_102368482
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- TGAACAATTTACCTGTCAATAAAGCAGAAGACGGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGTTTTAAAGTTCCCAGTGGTCCGTTTGGATGTGGTAACATGTCACCCGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	14	r	102468482	102593486	37	99.7	Perfect prediction

Length: 1760 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI55542	100.0	CDC42 binding p...	Homo sapiens
Q9Y5S2	99.9	Serine/threonin...	Homo sapiens
AAD37506	99.8	CDC42-binding p...	Homo sapiens
XP_510180	98.0	CDC42-binding p...	Pan troglodytes
EDL18639	91.9	Cdc42 binding p...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB007920	2.4e-58	52.1	KIAA0451
AB014519	6e-32	29.8	KIAA0619
AB011133	5.3e-11	31.2	KIAA0561
AB002301	7e-11	30.3	KIAA0303
AB018350	7.4e-11	35.8	KIAA0807

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	125	391	PD000001	Protein kinase
FPrintScan	IPR002219	1072	1086	PR00008	Protein kinase C
	IPR002219	1088	1097	PR00008	Protein kinase C
	IPR002219	1101	1112	PR00008	Protein kinase C
	IPR002219	1113	1125	PR00008	Protein kinase C
HMMPfam	IPR000719	125	391	PF00069	Protein kinase
	IPR000961	409	456	PF00433	Protein kinase
	IPR014930	927	988	PF08826	DMPK coiled coil
	IPR002219	1075	1127	PF00130	Protein kinase C
	IPR001849	1145	1263	PF00169	Pleckstrin-like
	IPR001180	1290	1562	PF00780	Citron-like
	IPR000095	1631	1645	PF00786	PAK-box/P21-Rho-binding
HMMSmart	IPR001245	125	391	SM00219	Tyrosine protein kinase
	IPR002290	125	391	SM00220	Serine/threonine protein kinase
	IPR000961	392	454	SM00133	Protein kinase
	IPR002219	1075	1124	SM00109	Protein kinase C
	IPR001849	1145	1265	SM00233	Pleckstrin-like
	IPR001180	1293	1568	SM00036	Citron-like
	IPR000095	1632	1667	SM00285	PAK-box/P21-Rho-binding
ProfileScan	IPR000719	125	391	PS50011	Protein kinase
	IPR002219	1074	1124	PS50081	Protein kinase C
	IPR001849	1144	1263	PS50003	Pleckstrin-like
	IPR000095	1632	1645	PS50108	PAK-box/P21-Rho-binding
ScanRegExp	IPR000719	131	154	PS00107	Protein kinase
	IPR008271	245	257	PS00108	Serine/threonine protein kinase
	IPR002219	1075	1124	PS00479	Protein kinase C

Primer_f	CCGTGATTAGTAGCCCGTATG
Primer_r	CAACATCTGGTACAAAGGGTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CCGTGATTAGTAGCCCGTATG
Primer_r	CAACATCTGGTACAAAGGGTG
PCR product length	123 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles