Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK05935 |
---|---|
Accession No | AB002301 |
Description | microtubule associated serine/threonine kinase family member 4 |
Clone name | hg00009 |
Vector information | |
cDNA sequence | DNA sequence (6629 bp) Predicted protein sequence (2137 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA0303
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR000719 | 84 | 357 | PD000001 | Protein kinase |
HMMPfam | IPR015022 | 1 | 46 | PF08926 | Domain of unknown function DUF1908 |
IPR000719 | 84 | 357 | PF00069 | Protein kinase | |
IPR000961 | 375 | 421 | PF00433 | Protein kinase | |
IPR001478 | 690 | 740 | PF00595 | PDZ/DHR/GLGF | |
HMMSmart | IPR002290 | 84 | 357 | SM00220 | Serine/threonine protein kinase |
IPR001245 | 84 | 357 | SM00219 | Tyrosine protein kinase | |
IPR001478 | 663 | 743 | SM00228 | PDZ/DHR/GLGF | |
ProfileScan | IPR000719 | 84 | 357 | PS50011 | Protein kinase |
IPR001478 | 655 | 743 | PS50106 | PDZ/DHR/GLGF | |
ScanRegExp | IPR008271 | 203 | 215 | PS00108 | Serine/threonine protein kinase |
RT-PCR |
---|
Primer_f | TTTGGTTTCCCCTACGGTGGC |
---|---|
Primer_r | CACCCTTGCCTCTGGATTCAC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TTTGGTTTCCCCTACGGTGGC |
Primer_r | CACCCTTGCCTCTGGATTCAC |
PCR product length | 105 bp |
PCR conditions | 95 °C15 sec66 °C60 sec30 cycles |