Gene/Protein Characteristic Table for KIAA0303
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK05935
Accession No AB002301
Description microtubule associated serine/threonine kinase family member 4
Clone name hg00009
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (6629 bp)
Predicted protein sequence (2137 aa)
Source Human adult brain
Rouge ID mKIAA0303 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 6629 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Features of the protein sequence
Description

Length: 2137 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
AAW52510 0 100.0 serine/threonin...
Homo sapiens
EAW51320 0 100.0 similar to micr...
Homo sapiens
NP_055998 0 99.9 microtubule ass...
Homo sapiens
O15021 0 99.9 Microtubule-ass...
Homo sapiens
EAW51321 0 97.2 similar to micr...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB011133 5.3e-49 58.8 KIAA0561
AB023190 5.4e-46 54.6 KIAA0973
AB018350 8.7e-44 52.7 KIAA0807
AB032950 2.5e-09 30.3 KIAA1124
AB023182 9.8e-06 35.5 KIAA0965
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR000719 84 357 PD000001 Protein kinase
HMMPfam IPR015022 1 46 PF08926 Domain of unknown function DUF1908
IPR000719 84 357 PF00069 Protein kinase
IPR000961 375 421 PF00433 Protein kinase
IPR001478 690 740 PF00595 PDZ/DHR/GLGF
HMMSmart IPR002290 84 357 SM00220 Serine/threonine protein kinase
IPR001245 84 357 SM00219 Tyrosine protein kinase
IPR001478 663 743 SM00228 PDZ/DHR/GLGF
ProfileScan IPR000719 84 357 PS50011 Protein kinase
IPR001478 655 743 PS50106 PDZ/DHR/GLGF
ScanRegExp IPR008271 203 215 PS00108 Serine/threonine protein kinase
Expression profile
Description

RT-PCR
Experimental conditions
Primer_f TTTGGTTTCCCCTACGGTGGC
Primer_r CACCCTTGCCTCTGGATTCAC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 5
Experimental conditions
Panel name GeneBridge 4
Primer_f TTTGGTTTCCCCTACGGTGGC
Primer_r CACCCTTGCCTCTGGATTCAC
PCR product length 105 bp
PCR conditions 95 °C15 sec66 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp