KIAA0973

Product ID	ORK00159
Accession No	AB023190
Description	microtubule associated serine/threonine kinase 1
Clone name	hj06871
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. This cDNA clone hj06871 has an irregular adapter sequence (GTCGACCCAC GCGTCCGCCC ACGCGTCCGC GCCG) instead of regular one (GTCGACCCAC GCGTCCG).
cDNA sequence	DNA sequence (4833 bp) Predicted protein sequence (1583 aa)
HaloTag ORF Clone	FHC00159
Flexi ORF Clone	FXC00159
Source	Human adult brain
Rouge ID	mKIAA0973 by Kazusa Mouse cDNA Project

Length: 4833 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	81 bp
Genome contig ID	gi42406306f_12710348
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- GTACACATATAAATAAAGTGCGTCCGTGCTGCGTG
Flanking genome sequence (136419 - 136468)	----+--------+--------+--------+--------+----* AGTTTTCTGGGGCTCACTCCTCTCCAGGCAAGGCGAGACATCACACGACC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	19	f	12810348	12846765	26	99.7	Perfect prediction

Length: 1583 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9Y2H9	100.0	Microtubule-ass...	Homo sapiens
XP_001109914	98.4	similar to micr...	Macaca mulatta
Q9R1L5	94.3	Microtubule-ass...	Mus musculus
Q810W7	93.9	Microtubule-ass...	Rattus norvegicus
AAD50548	92.2	syntrophin-asso...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018350	3.3e-97	58.5	KIAA0807
AB011133	4.2e-84	59.4	KIAA0561
AB002301	3.6e-52	54.6	KIAA0303
AB032950	2e-10	35.4	KIAA1124
AB023182	3.4e-07	36.8	KIAA0965

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	390	660	PD000001	Protein kinase
HMMPfam	IPR015022	72	351	PF08926	Domain of unknown function DUF1908
	IPR000719	387	660	PF00069	Protein kinase
	IPR000961	678	723	PF00433	Protein kinase
	IPR001478	1015	1065	PF00595	PDZ/DHR/GLGF
HMMSmart	IPR001245	387	660	SM00219	Tyrosine protein kinase
	IPR002290	387	660	SM00220	Serine/threonine protein kinase
	IPR001478	988	1068	SM00228	PDZ/DHR/GLGF
ProfileScan	IPR000719	387	660	PS50011	Protein kinase
ProfileScan	IPR001478	980	1068	PS50106	PDZ/DHR/GLGF
ScanRegExp	IPR008271	506	518	PS00108	Serine/threonine protein kinase

Primer_f	AACGCCCTTCGAAAATACCTC
Primer_r	CTAGTATGCAGCAGGTTCGAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	AACGCCCTTCGAAAATACCTC
Primer_r	CTAGTATGCAGCAGGTTCGAC
PCR product length	171 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles