Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00544 |
---|---|
Accession No | AB007939 |
Description | centrosomal protein 170kDa, transcript variant gamma |
Clone name | hg01996 |
Vector information | |
cDNA sequence | DNA sequence (6456 bp) Predicted protein sequence (1472 aa) |
HaloTag ORF Clone |
FHC00544
|
Flexi ORF Clone | FXC00544 |
Source | Human adult brain |
Rouge ID |
mKIAA0470
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Primer_f | |
---|---|
Primer_r | |
PCR conditions | °C sec °C sec cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | ACATCCTGGTTTTTGGTGAGC |
Primer_r | ACACTACGAGACTGCAACATG |
PCR product length | 107 bp |
PCR conditions | 95 °C15 sec62 °C60 sec30 cycles |