|
Order Kazusa clone(s) from : |
| Product ID | ORK00091 |
|---|---|
| Accession No | AB011091 |
| Description | exostosin-like glycosyltransferase 3, transcript variant 1 |
| Clone name | hg01237 |
| Vector information | |
| cDNA sequence | DNA sequence (6189 bp) Predicted protein sequence (931 aa) |
|
HaloTag ORF Clone |
FHC00091
|
| Flexi ORF Clone | FXC00091 |
| Source | Human adult brain |
| Rouge ID |
mKIAA0519
by Kazusa Mouse cDNA Project
|
Length: 6189 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | No warning | No warning |
Length: 931 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database
(FASTA output,
Multiple alignment)
Result of motif / domain search (InterProScan and SOSUI)
Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| HMMPfam | IPR004263 | 208 | 524 | PF03016 | Exostosin-like |
| IPR015338 | 675 | 916 | PF09258 | EXTL2 |
Prediction of transmembrane (TM) segments| Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 41 | LTWLSFTLFVILVFFPLIAHYYL | 63 | PRIMARY | 23 |
|---|
RT-PCR
|
|---|
Experimental conditions| Primer_f | TTTAGTGGAGCCAGGTTGTCG |
|---|---|
| Primer_r | CCTGCGGCATGTTTTGGTGTC |
| PCR conditions | 95 °C 30 sec 55 °C 30 sec 72 °C 60 sec 30 cycles![]() |
Chromosome No. 8
Experimental conditions| Panel name | GeneBridge 4 |
|---|---|
| Primer_f | GCGCACTCCCAGAAAGATCCC |
| Primer_r | CATAACACCGTCCCAGGGCTC |
| PCR product length | 140 bp |
| PCR conditions | 95 °C 15 sec 68 °C 60 sec 30 cycles |