Order Kazusa clone(s) from : ![]() |
Product ID | ORK00095 |
---|---|
Accession No | AB011118 |
Description | zinc finger, C3H1-type containing |
Clone name | ef04555 |
Vector information | |
cDNA sequence | DNA sequence (7597 bp) Predicted protein sequence (1919 aa) |
HaloTag ORF Clone |
FHC00095
![]() |
Flexi ORF Clone | FXC00095 |
Source | |
Rouge ID |
mKIAA0546
by Kazusa Mouse cDNA Project
|
Note | We replaced hh00504, former representative clones for KIAA0546 with ef04555. (2003/4/2) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1655 bp |
---|---|
Genome contig ID | gi89161190r_70189745 |
PolyA signal sequence (AATAAA,-18) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 12 | r | 70289745 | 70343866 | 34 | 99.9 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMSmart | IPR003107 | 1390 | 1422 | SM00386 | RNA-processing protein |
IPR003107 | 1424 | 1455 | SM00386 | RNA-processing protein | |
IPR003107 | 1659 | 1691 | SM00386 | RNA-processing protein | |
IPR003107 | 1768 | 1803 | SM00386 | RNA-processing protein | |
ProfileScan | IPR013026 | 1370 | 1443 | PS50293 | Tetratricopeptide region |
IPR013026 | 1611 | 1678 | PS50293 | Tetratricopeptide region |
![]() |
---|
Primer_f | GATGGCTGTTCTCCTTGTTAG |
---|---|
Primer_r | TCCTGTAGACTGTTCCTCATC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | GATGGCTGTTCTCCTTGTTAG |
Primer_r | TCCTGTAGACTGTTCCTCATC |
PCR product length | 154 (0.7k) bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |