KIAA0555

Product ID	ORK01092
Accession No	AB011127
Description	janus kinase and microtubule interacting protein 2, transcript variant 2
Clone name	hh00882
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5913 bp) Predicted protein sequence (802 aa)
HaloTag ORF Clone	FHC01092
Flexi ORF Clone	FXC01092
Source	Human adult brain

Length: 5913 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	3278 bp
Genome contig ID	gi51511721r_146848183
PolyA signal sequence (None)	+--------+--------+----*----+---- GAATGCTTCCCTTGGATGGGATGTTCAGCAATAGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAGTTATCAATAACTGAGATTTCCTGTGGCCCCA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	5	r	146948183	147142298	21	99.4	Perfect prediction

Length: 802 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW61821	0	100.0	janus kinase an...	Homo sapiens
Q96AA8	2.1e-165	97.4	Janus kinase an...	Homo sapiens
EAW61820	2.1e-165	97.4	janus kinase an...	Homo sapiens
AAI20005	6.2e-165	97.1	Janus kinase an...	Bos taurus
XP_001102707	6.9e-165	97.1	Jak and microtu...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020673	7.4e-05	23.6	KIAA0866
AB023166	0.001	23.8	KIAA0949

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	781	KDLEEKFLFLFLFFSLAFILWP	802	PRIMARY	22

Primer_f	CAAGCTGCCAATGAAGACCTC
Primer_r	TGACATTTCCTGCTCGTGCTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	ATTCCGTCTGCTCCAACACAC
Primer_r	CCCTAAACACATCTAAAGCTG
PCR product length	75 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles