Order Kazusa clone(s) from : ![]() |
Product ID | ORK01097 |
---|---|
Accession No | AB011155 |
Description | discs, large homolog 5 (Drosophila) |
Clone name | af01829 |
Vector information | |
cDNA sequence | DNA sequence (7507 bp) Predicted protein sequence (1952 aa) |
HaloTag ORF Clone |
FHC01097
![]() |
Flexi ORF Clone | FXC01097 |
Source | Human brain (amygdala) |
Rouge ID |
mKIAA0583
by Kazusa Mouse cDNA Project
|
Note | We replaced hj00729, former representative clones for KIAA0583 with af01829. (2005/08/06) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 1647 bp |
---|---|
Genome contig ID | gi89161187r_79120557 |
PolyA signal sequence (AATAAA,-19) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 10 | r | 79220557 | 79356384 | 32 | 99.7 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001315 | 39 | 122 | PF00619 | Caspase Recruitment |
IPR006907 | 160 | 249 | PF04822 | Protein of unknown function DUF622 | |
IPR001478 | 655 | 740 | PF00595 | PDZ/DHR/GLGF | |
IPR001478 | 755 | 826 | PF00595 | PDZ/DHR/GLGF | |
IPR001478 | 1383 | 1459 | PF00595 | PDZ/DHR/GLGF | |
IPR001478 | 1534 | 1612 | PF00595 | PDZ/DHR/GLGF | |
IPR011511 | 1630 | 1692 | PF07653 | Variant SH3 | |
IPR008144 | 1834 | 1873 | PF00625 | Guanylate kinase | |
HMMSmart | IPR001478 | 666 | 743 | SM00228 | PDZ/DHR/GLGF |
IPR001478 | 751 | 829 | SM00228 | PDZ/DHR/GLGF | |
IPR001478 | 1391 | 1462 | SM00228 | PDZ/DHR/GLGF | |
IPR001478 | 1543 | 1615 | SM00228 | PDZ/DHR/GLGF | |
IPR001452 | 1629 | 1693 | SM00326 | Src homology-3 | |
IPR008145 | 1755 | 1941 | SM00072 | Guanylate kinase/L-type calcium channel region | |
ProfileScan | IPR001315 | 34 | 123 | PS50209 | Caspase Recruitment |
IPR001478 | 653 | 743 | PS50106 | PDZ/DHR/GLGF | |
IPR001478 | 738 | 829 | PS50106 | PDZ/DHR/GLGF | |
IPR001478 | 1383 | 1462 | PS50106 | PDZ/DHR/GLGF | |
IPR001478 | 1534 | 1615 | PS50106 | PDZ/DHR/GLGF | |
IPR001452 | 1626 | 1694 | PS50002 | Src homology-3 | |
IPR008144 | 1808 | 1938 | PS50052 | Guanylate kinase | |
ScanRegExp | IPR000408 | 1549 | 1559 | PS00626 | Regulator of chromosome condensation |
![]() |
---|
Primer_f | ACAAGTTTCAGTCCTCAATGC |
---|---|
Primer_r | GAAAATCCCAGTCTGTCAGCT |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | ACAAGTTTCAGTCCTCAATGC |
Primer_r | GAAAATCCCAGTCTGTCAGCT |
PCR product length | 206 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |