KIAA0607

Gene/Protein Characteristic Table for KIAA0607

Order Kazusa clone(s) from :

Product ID	ORK00573
Accession No	AB011179
Description	neurochondrin, transcript variant 2
Clone name	hh00181a
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3311 bp) Predicted protein sequence (731 aa)
HaloTag ORF Clone	FHC00573
Flexi ORF Clone	FXC00573
Source	Human adult brain
Rouge ID	mKIAA0607 by Kazusa Mouse cDNA Project

Features of the cloned cDNA sequence

Description

Length: 3311 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1114 bp
Genome contig ID	gi89161185f_35696032
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- TGCACATGTGGACACTCAATAAATGTTCATTGGTG
Flanking genome sequence (108930 - 108979)	----+--------+--------+--------+--------+----* ACGAGAAGCCTCCTGCGTGGTCTGCCCTGCACCTGCTCTCTCCCTTCCAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	f	35796032	35804960	7	99.5	Perfect prediction

Features of the protein sequence

Description

Length: 731 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001102087	99.7	similar to neur...	Macaca mulatta
XP_513308	99.9	neurochondrin [...	Pan troglodytes
AAD05029	99.3	unknown [Homo s...	Homo sapiens
Q9UBB6	99.3	Neurochondrin.	Homo sapiens
BAA77831	100.0	neurochondrin-2...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR008709	20	731	PF05536	Neurochondrin

Expression profile

Description

RT-PCR

Experimental conditions

Primer_f	CCTGTCCTTATCCCTGCTTGG
Primer_r	GTAATCACTGGGGAAACATGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 1

Experimental conditions

Panel name	GeneBridge 4
Primer_f	CCTGTCCTTATCCCTGCTTGG
Primer_r	GTAATCACTGGGGAAACATGC
PCR product length	126 bp
PCR conditions	95 °C15 sec67 °C60 sec30 cycles

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp