KIAA0612

Product ID	ORK01985
Accession No	AB014512
Description	benzodiazepine receptor (peripheral) associated protein 1, transcript variant 2
Clone name	hg00654s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (7479 bp) Predicted protein sequence (1810 aa)
HaloTag ORF Clone	FHC01985
Flexi ORF Clone	FXC01985
Source	Human adult brain
Rouge ID	mKIAA0612 by Kazusa Mouse cDNA Project
Note	We replaced hg00654, former representative clones for KIAA0612 with hg00654s1. (2003/8/28)

Length: 7479 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1245 bp
Genome contig ID	gi51511734r_53633595
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- AAAAGACATTTTATTATAATAAAGTCTATTTTCAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAATCTATGCTGGACTCTCCATGGGCAAAGGACTCCTTGGAGGGGTGGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	r	53733595	53761120	31	99.7	Perfect prediction

Length: 1810 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI50280	100.0	BZRAP1 protein ...	Homo sapiens
EAW94469	99.8	benzodiazapine ...	Homo sapiens
NP_077729	99.7	peripheral benz...	Homo sapiens
EAW94468	96.6	benzodiazapine ...	Homo sapiens
O95153	96.5	Peripheral-type...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051453	5.7e-10	30.0	KIAA1666
AB002316	1.3e-05	32.6	KIAA0318

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001452	609	669	PD000066	Src homology-3
	IPR001452	1583	1642	PD000066	Src homology-3
	IPR001452	1723	1780	PD000066	Src homology-3
FPrintScan	IPR001452	1581	1591	PR00452	Src homology-3
	IPR001452	1603	1618	PR00452	Src homology-3
	IPR001452	1632	1644	PR00452	Src homology-3
HMMPfam	IPR011511	620	671	PF07653	Variant SH3
	IPR011511	1582	1644	PF07653	Variant SH3
	IPR011511	1721	1781	PF07653	Variant SH3
HMMSmart	IPR001452	609	672	SM00326	Src homology-3
	IPR003961	744	821	SM00060	Fibronectin
	IPR003961	835	908	SM00060	Fibronectin
	IPR003961	932	1019	SM00060	Fibronectin
	IPR001452	1581	1645	SM00326	Src homology-3
	IPR001452	1720	1783	SM00326	Src homology-3
ProfileScan	IPR001452	606	673	PS50002	Src homology-3
	IPR003961	741	830	PS50853	Fibronectin
	IPR003961	834	917	PS50853	Fibronectin
	IPR003961	931	1029	PS50853	Fibronectin
	IPR001452	1578	1646	PS50002	Src homology-3
	IPR001452	1717	1784	PS50002	Src homology-3

Primer_f	TCAGTGCCTCAGTTCAGCTTC
Primer_r	AATAAGGCAAACCCAACTCCG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	AAGGTCAAGGTGGGGGTTCAG
Primer_r	TTCAGAGTGGGGTAGGGGTTC
PCR product length	133 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles