KIAA1666

Product ID	ORK05699
Accession No	AB051453
Description	Homo sapiens mRNA for KIAA1666 protein, partial cds.
Clone name	fg02554
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5477 bp) Predicted protein sequence (1003 aa)
Source	Human fetal brain
Rouge ID	mKIAA1666 by Kazusa Mouse cDNA Project

Length: 5477 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	700 bp
Genome contig ID	gi89161203f_19968293
PolyA signal sequence (ATTAAA,-16)	+--------+--------+----*----+---- GTCTTATGTCCAACCCCTCATTAAAATGTTCATAG
Flanking genome sequence (105476 - 105525)	----+--------+--------+--------+--------+----* AAAAAACATATTTTAGAAGTTGAAGCACAACCAAGGAAACATGAGCCTGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	22	r	18835682	18841156	1	99.0	Perfect prediction
Ensembl gnome browser	22	f	20068293	20073767	1	99.0	Perfect prediction
Ensembl gnome browser	22	r	20229646	20235120	1	99.0	Perfect prediction

Length: 1003 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAB61362	98.9	hypothetical pr...	Homo sapiens
Q9UFD9	98.9	RIMS-binding pr...	Homo sapiens
AAI67855	98.9	RIMS binding pr...	synthetic construct
A6NNM3	98.4	RIMS-binding pr...	Homo sapiens
A6NJZ7	98.4	RIMS-binding pr...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB014512	5.2e-19	30.2	KIAA0612
AB002316	1.7e-09	28.6	KIAA0318

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001452	199	259	PD000066	Src homology-3
	IPR001452	820	880	PD000066	Src homology-3
	IPR001452	939	996	PD000066	Src homology-3
FPrintScan	IPR001452	199	209	PR00452	Src homology-3
	IPR001452	219	234	PR00452	Src homology-3
	IPR001452	249	261	PR00452	Src homology-3
HMMPfam	IPR011511	200	261	PF07653	Variant SH3
	IPR011511	820	882	PF07653	Variant SH3
	IPR011511	937	998	PF07653	Variant SH3
HMMSmart	IPR001452	199	262	SM00326	Src homology-3
	IPR001452	819	883	SM00326	Src homology-3
	IPR001452	936	999	SM00326	Src homology-3
ProfileScan	IPR001452	196	263	PS50002	Src homology-3
ProfileScan	IPR001452	933	1000	PS50002	Src homology-3

Primer_f
Primer_r
PCR conditions	test

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-