Gene/Protein Characteristic Table for KIAA0318
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK01971
Accession No AB002316
Description RIMS binding protein 2
Clone name hg00364
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (6322 bp)
Predicted protein sequence (1106 aa)
Flexi ORF Clone FXC01971
Source Human adult brain
Rouge ID mKIAA0318 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 6322 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Features of the protein sequence
Description

Length: 1106 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
O15034 0 100.0 RIMS-binding pr...
Homo sapiens
EAW98512 0 99.9 RIMS binding pr...
Homo sapiens
XP_857096 0 86.2 similar to RIM ...
Canis lupus fam...
XP_001073349 0 84.8 similar to RIM ...
Rattus norvegicus
XP_001064396 0 84.8 similar to RIM ...
Rattus norvegicus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB014512 2.9e-09 32.7 KIAA0612
AB051453 1.6e-07 28.5 KIAA1666
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR001452 226 283 PD000066 Src homology-3
IPR001452 907 965 PD000066 Src homology-3
IPR001452 1012 1069 PD000066 Src homology-3
FPrintScan IPR001452 905 915 PR00452 Src homology-3
IPR001452 927 942 PR00452 Src homology-3
IPR001452 1059 1071 PR00452 Src homology-3
HMMPfam IPR011511 235 286 PF07653 Variant SH3
IPR003961 351 431 PF00041 Fibronectin
IPR003961 445 517 PF00041 Fibronectin
IPR003961 541 627 PF00041 Fibronectin
IPR011511 906 968 PF07653 Variant SH3
IPR011511 1010 1071 PF07653 Variant SH3
HMMSmart IPR001452 224 287 SM00326 Src homology-3
IPR003961 351 431 SM00060 Fibronectin
IPR003961 445 517 SM00060 Fibronectin
IPR003961 541 627 SM00060 Fibronectin
IPR001452 905 969 SM00326 Src homology-3
IPR001452 1009 1072 SM00326 Src homology-3
ProfileScan IPR001452 221 288 PS50002 Src homology-3
IPR003961 352 440 PS50853 Fibronectin
IPR003961 444 527 PS50853 Fibronectin
IPR003961 540 637 PS50853 Fibronectin
IPR001452 902 970 PS50002 Src homology-3
IPR001452 1006 1073 PS50002 Src homology-3
Expression profile
Description

RT-PCR
Experimental conditions
Primer_f CCACACAGAGCTTAACCACAC
Primer_r GCTGGCAGATGTATTTGATGG
PCR conditions 95 °C15 sec55 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 12
Experimental conditions
Panel name GeneBridge 4
Primer_f CCACACAGAGCTTAACCACAC
Primer_r GCTGGCAGATGTATTTGATGG
PCR product length 236 bp
PCR conditions 95 °C15 sec64 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp