Order Kazusa clone(s) from : ![]() |
Product ID | ORK00582 |
---|---|
Accession No | AB014534 |
Description | astrotactin 2, transcript variant 1 |
Clone name | hj03064 |
Vector information | |
cDNA sequence | DNA sequence (4591 bp) Predicted protein sequence (1321 aa) |
HaloTag ORF Clone |
FHC00582
![]() |
Flexi ORF Clone | FXC00582 |
Source | Human adult brain |
Rouge ID |
mKIAA0634
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 623 bp |
---|---|
Genome contig ID | gi89161216r_118127328 |
PolyA signal sequence (ATTAAA,-23) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 9 | r | 118227328 | 119217138 | 22 | 99.7 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR003961 | 1048 | 1164 | PF00041 | Fibronectin |
HMMSmart | IPR001862 | 833 | 1017 | SM00457 | Membrane attack complex component/perforin/complement C9 |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 2 | ASASAVSAAASSSSFATAATAAA | 24 | SECONDARY | 23 | 2 | 236 | HILHISVMGGLIALLLLLLVFTV | 258 | PRIMARY | 23 | 3 | 415 | NKTALTLIAVSSCILAMVCGSQ | 436 | PRIMARY | 22 |
---|
![]() |
---|
![]() |
Primer_f | CTATGGAGGGACAGTTTTGAC |
---|---|
Primer_r | GGTCCCACAAACTCAATAATG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CTATGGAGGGACAGTTTTGAC |
Primer_r | GGTCCCACAAACTCAATAATG |
PCR product length | 155 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |