KIAA0289

Product ID	ORK00497
Accession No	AB006627
Description	astrotactin 1, transcript variant 1
Clone name	ha06244
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pSPORT1 vector (GenBank Accession No. U12390, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (7127 bp) Predicted protein sequence (1302 aa)
HaloTag ORF Clone	FHC00497
Flexi ORF Clone	FXC00497
Source	Human adult brain
Rouge ID	mKIAA0289 by Kazusa Mouse cDNA Project

Length: 7127 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3216 bp
Genome contig ID	gi89161185r_174996827
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- ATTAACTGAATAATAAAACAAAGCTATTAGTAAGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTGGGTATGTGGATGTTGTGTCTTTCAGTAATCTGAGTGAACTGGTTAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	r	175096827	175400449	23	99.4	Terminal No-hit

Length: 1302 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_514021	99.9	astrotactin [Pa...	Pan troglodytes
EAW91006	100.0	astrotactin, is...	Homo sapiens
XP_001105186	99.9	similar to astr...	Macaca mulatta
CAH71678	99.8	astrotactin 1 [...	Homo sapiens
EAW91005	99.4	astrotactin, is...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB014534	1.5e-203	48.9	KIAA0634

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMSmart	IPR006210	470	507	SM00181	EGF
	IPR006210	611	652	SM00181	EGF
	IPR006210	659	708	SM00181	EGF
	IPR001862	811	999	SM00457	Membrane attack complex component/perforin/complement C9
ProfileScan	IPR003961	1030	1151	PS50853	Fibronectin

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	9	MALAGLCALLACCWGPAAVLATA	31	PRIMARY	23
SOSUI2	2	160	LHISVMGGMIALLLSILCLVMIL	182	PRIMARY	23

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	CTATGACTGGCTCCTACTTAC
Primer_r	GTACCATCACCCTTTCTAGCC
PCR product length	189 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles