Gene/Protein Characteristic Table for KIAA0636
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00583
Accession No AB014536
Description copine III
Clone name hj03289
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4737 bp)
Predicted protein sequence (540 aa)
Flexi ORF Clone FXC00583
Source Human adult brain
Rouge ID mKIAA0636 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4737 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Features of the protein sequence
Description

Length: 540 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_519845 0 99.3 copine III [Pan...
Pan troglodytes
O75131 0 100.0 Copine-3; Copin...
Homo sapiens
AAV38382 0 100.0 copine III [syn...
synthetic construct
BAF85601 0 99.8 unnamed protein...
Homo sapiens
XP_001082722 0 98.9 copine III [Mac...
Macaca mulatta
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB046819 9.3e-82 52.1 KIAA1599
AB037763 0.00012 23.5 KIAA1342
AB023202 0.00072 27.4 KIAA0985
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR000008 26 38 PR00360 C2 calcium-dependent membrane targeting
IPR000008 56 69 PR00360 C2 calcium-dependent membrane targeting
IPR000008 78 86 PR00360 C2 calcium-dependent membrane targeting
HMMPfam IPR000008 12 102 PF00168 C2 calcium-dependent membrane targeting
IPR000008 143 233 PF00168 C2 calcium-dependent membrane targeting
IPR010734 313 460 PF07002 Copine
HMMSmart IPR000008 10 117 SM00239 C2 calcium-dependent membrane targeting
IPR000008 142 248 SM00239 C2 calcium-dependent membrane targeting
IPR002035 292 494 SM00327 von Willebrand factor
ProfileScan IPR000008 1 102 PS50004 C2 calcium-dependent membrane targeting
IPR000008 141 233 PS50004 C2 calcium-dependent membrane targeting
Expression profile
Description

RT-PCR
RT-PCR-ELISA
Experimental conditions
Primer_f TTCCCTGTTGTGCCACCATTC
Primer_r TTACATCTATCCTGGGCACCG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 8
Experimental conditions
Panel name GeneBridge 4
Primer_f TTCCCTGTTGTGCCACCATTC
Primer_r TTACATCTATCCTGGGCACCG
PCR product length 145 bp
PCR conditions 95 °C15 sec64 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp