Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00583 |
---|---|
Accession No | AB014536 |
Description | copine III |
Clone name | hj03289 |
Vector information | |
cDNA sequence | DNA sequence (4737 bp) Predicted protein sequence (540 aa) |
HaloTag ORF Clone |
FHC00583
|
Flexi ORF Clone | FXC00583 |
Source | Human adult brain |
Rouge ID |
mKIAA0636
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR000008 | 26 | 38 | PR00360 | C2 calcium-dependent membrane targeting |
IPR000008 | 56 | 69 | PR00360 | C2 calcium-dependent membrane targeting | |
IPR000008 | 78 | 86 | PR00360 | C2 calcium-dependent membrane targeting | |
HMMPfam | IPR000008 | 12 | 102 | PF00168 | C2 calcium-dependent membrane targeting |
IPR000008 | 143 | 233 | PF00168 | C2 calcium-dependent membrane targeting | |
IPR010734 | 313 | 460 | PF07002 | Copine | |
HMMSmart | IPR000008 | 10 | 117 | SM00239 | C2 calcium-dependent membrane targeting |
IPR000008 | 142 | 248 | SM00239 | C2 calcium-dependent membrane targeting | |
IPR002035 | 292 | 494 | SM00327 | von Willebrand factor | |
ProfileScan | IPR000008 | 1 | 102 | PS50004 | C2 calcium-dependent membrane targeting |
IPR000008 | 141 | 233 | PS50004 | C2 calcium-dependent membrane targeting |
RT-PCR |
---|
RT-PCR-ELISA |
Primer_f | TTCCCTGTTGTGCCACCATTC |
---|---|
Primer_r | TTACATCTATCCTGGGCACCG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TTCCCTGTTGTGCCACCATTC |
Primer_r | TTACATCTATCCTGGGCACCG |
PCR product length | 145 bp |
PCR conditions | 95 °C15 sec64 °C60 sec30 cycles |