Gene/Protein Characteristic Table for KIAA0637
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK01598
Accession No AB014537
Description zinc finger, BED-type containing 4
Clone name hj03305
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (5217 bp)
Predicted protein sequence (1175 aa)
Flexi ORF Clone FXC01598
Source Human adult brain
Rouge ID mKIAA0637 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 5217 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Features of the protein sequence
Description

Length: 1175 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
O75132 0 100.0 Zinc finger BED...
Homo sapiens
CAB62924 0 99.9 zinc finger, BE...
Homo sapiens
AAI17671 0 99.9 Zinc finger, BE...
Homo sapiens
XP_001111467 0 98.3 zinc finger, BE...
Macaca mulatta
XP_001914855 0 87.3 zinc finger, BE...
Equus caballus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB018328 3.6e-18 25.5 KIAA0785
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR003656 122 170 PF02892 Zinc finger
IPR003656 292 340 PF02892 Zinc finger
IPR003656 463 510 PF02892 Zinc finger
IPR003656 565 613 PF02892 Zinc finger
IPR008906 1088 1168 PF05699 HAT dimerisation
HMMSmart IPR003656 119 172 SM00614 Zinc finger
IPR003656 289 342 SM00614 Zinc finger
IPR003656 460 512 SM00614 Zinc finger
IPR003656 562 615 SM00614 Zinc finger
ProfileScan IPR003656 119 176 PS50808 Zinc finger
IPR003656 289 346 PS50808 Zinc finger
IPR003656 460 516 PS50808 Zinc finger
IPR003656 562 619 PS50808 Zinc finger
Expression profile
Description

RT-PCR
RT-PCR-ELISA
Experimental conditions
Primer_f TTATGATAGGGAAGATGCGGC
Primer_r AAGGTCGTAGGCAAATGAGTG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 22
Experimental conditions
Panel name GeneBridge 4
Primer_f TTATGATAGGGAAGATGCGGC
Primer_r AAGGTCGTAGGCAAATGAGTG
PCR product length 181 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp