Gene/Protein Characteristic Table for KIAA0785
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00638
Accession No AB018328
Description zinc finger, BED-type containing 1, transcript variant 2
Clone name hk05482
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4485 bp)
Predicted protein sequence (706 aa)
Flexi ORF Clone FXC00638
Source Human adult brain
Features of the cloned cDNA sequence
Description

Length: 4485 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Integrity of 3' end
Length of 3'UTR 2199 bp
Genome contig ID gi89161218r_2314477
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
AAGTTGGACTGTTGTTCAATAAACCAGAGCAATGC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATTAGCTCCTCATTCATTTGTCTGCCGCGTGTCCGTCTGGACTGCAGTTT
Features of the protein sequence
Description

Length: 706 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
O96006 0 100.0 Zinc finger BED...
Homo sapiens
AAH15030 0 99.9 ZBED1 protein [...
Homo sapiens
XP_548835 0 89.1 similar to Zinc...
Canis lupus fam...
XP_001916820 0 86.0 similar to Zinc...
Equus caballus
CAJ83469 1.5e-201 76.4 zinc finger, BE...
Xenopus (Silura...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB014537 4e-25 25.0 KIAA0637
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR003656 35 84 PF02892 Zinc finger
IPR008906 583 663 PF05699 HAT dimerisation
HMMSmart IPR003656 32 86 SM00614 Zinc finger
ProfileScan IPR003656 32 90 PS50808 Zinc finger
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f ATATTGCTTGGATTCTACGTG
Primer_r GGACGTAAGGATAACATTCTG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 2
Experimental conditions
Panel name GeneBridge 4
Primer_f ATATTGCTTGGATTCTACGTG
Primer_r GGACGTAAGGATAACATTCTG
PCR product length 219 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp