Gene/Protein Characteristic Table for KIAA0661
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK01601
Accession No AB014561
Description ring finger protein 40, E3 ubiquitin protein ligase, transcript variant 1
Clone name hk01952
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4199 bp)
Predicted protein sequence (1030 aa)
Flexi ORF Clone FXC01601
Source Human adult brain
Rouge ID mKIAA0661 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4199 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Features of the protein sequence
Description

Length: 1030 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_001102375 0 98.2 similar to ring...
Macaca mulatta
O75150 0 100.0 E3 ubiquitin-pr...
Homo sapiens
AAP36593 0 100.0 ring finger pro...
synthetic construct
CAH10518 0 99.9 hypothetical pr...
Homo sapiens
BAF84355 0 99.9 unnamed protein...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB029004 3.8e-05 22.3 KIAA1081
AB032993 0.00095 23.8 KIAA1167
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001841 977 1015 PF00097 Zinc finger
HMMSmart IPR001841 977 1015 SM00184 Zinc finger
ProfileScan IPR001841 977 1016 PS50089 Zinc finger
ScanRegExp IPR001841 992 1001 PS00518 Zinc finger
Expression profile
Description

RT-PCR
RT-PCR-ELISA
Experimental conditions
Primer_f CCTAACCCTGCTTTCATCCTG
Primer_r GCTGGAATGATTGGAAGTTGG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 16
Experimental conditions
Panel name GeneBridge 4
Primer_f CCTAACCCTGCTTTCATCCTG
Primer_r GCTGGAATGATTGGAAGTTGG
PCR product length 111 bp
PCR conditions 95 °C15 sec64 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp