KIAA0663

Product ID	ORK00597
Accession No	AB014563
Description	zinc finger CCCH-type containing 11A
Clone name	hk02006
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4365 bp) Predicted protein sequence (816 aa)
HaloTag ORF Clone	FHC00597
Flexi ORF Clone	FXC00597
Source	Human adult brain
Rouge ID	mKIAA0663 by Kazusa Mouse cDNA Project

Length: 4365 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1719 bp
Genome contig ID	gi89161185f_201952678
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- ATACTTGTTTGTGTTTTAAATAAAACTGATGTAGG
Flanking genome sequence (137193 - 137242)	----+--------+--------+--------+--------+----* AAAGTCTTGATGTTGTGAGCTAAGTAATCTTACATCATCATATCAGCCTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	f	202050656	202089869	17	99.5	Perfect prediction
Ensembl gnome browser	1	r	217847893	217887256	3	97.1	Internal No-hit
Ensembl gnome browser	6	f	66006692	66073272	3	97.0	Both No-hit

Length: 816 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O75152	100.0	Zinc finger CCC...	Homo sapiens
CAH10566	99.9	hypothetical pr...	Homo sapiens
XP_001157064	99.8	zinc finger CCC...	Pan troglodytes
CAH10525	99.6	hypothetical pr...	Homo sapiens
CAH10530	99.8	hypothetical pr...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMSmart	IPR000571	9	34	SM00356	Zinc finger
	IPR000571	38	62	SM00356	Zinc finger
	IPR000571	66	92	SM00356	Zinc finger

Primer_f	AGCAGAGGTAGAATGTTCAGG
Primer_r	TGCGGAACACGAAACATTGAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	AGCAGAGGTAGAATGTTCAGG
Primer_r	TGCGGAACACGAAACATTGAC
PCR product length	174 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles