KIAA0670

Product ID	ORK04025
Accession No	AB014570
Description	apoptotic chromatin condensation inducer 1
Clone name	hk02359s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4444 bp) Predicted protein sequence (1286 aa)
Source	Human adult brain
Rouge ID	mKIAA0670 by Kazusa Mouse cDNA Project
Note	We replaced hk02359, former representative clones for KIAA0670 with hk02359s1. (2002/12/27)

Length: 4444 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	581 bp
Genome contig ID	gi51511730r_22497689
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- CTATGGAAAAAAAAATAAAAATCTGACTTAGTTTT
Flanking genome sequence (99927 - 99878)	----+--------+--------+--------+--------+----* AAACTGTGTGAGTGGCTTTCTTTGGGCAGGTTAAGAAGCCACTGTGGATA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	14	r	22597616	22634172	19	99.7	Perfect prediction

Length: 1286 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9UKV3	99.9	Apoptotic chrom...	Homo sapiens
XP_001160907	99.4	apoptotic chrom...	Pan troglodytes
XP_001106207	98.4	apoptotic chrom...	Macaca mulatta
XP_001494154	92.8	similar to Apop...	Equus caballus
XP_849010	91.9	similar to Apop...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003034	17	51	PF02037	DNA-binding SAP
HMMSmart	IPR003034	17	51	SM00513	DNA-binding SAP
ProfileScan	IPR003034	17	51	PS50800	DNA-binding SAP

Primer_f	TTCCTCCATCCTGCTTACCAC
Primer_r	GATATAAAGTGGAACCTGTGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TTCCTCCATCCTGCTTACCAC
Primer_r	GATATAAAGTGGAACCTGTGG
PCR product length	183 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles