KIAA0679

Gene/Protein Characteristic Table for KIAA0679

Order Kazusa clone(s) from :

Product ID	ORK01602
Accession No	AB014579
Description	meningioma expressed antigen 5 (hyaluronidase), transcript variant 1
Clone name	hk02739s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4755 bp) Predicted protein sequence (917 aa)
HaloTag ORF Clone	FHC01602
Flexi ORF Clone	FXC01602
Source	Human adult brain
Rouge ID	mKIAA0679 by Kazusa Mouse cDNA Project
Note	We replaced hk02739, former representative clones for KIAA0679 with hk02739s1. (2002/5/10)

Features of the cloned cDNA sequence

Description

Length: 4755 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1999 bp
Genome contig ID	gi89161187r_103434199
PolyA signal sequence (AATAAA,-16)	+--------+--------+----*----+---- AAGACCATGCAAGAGGCAAAATAAAACTTGAAGTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATGCTTGTCGTGTTGTATTGTGTGAATCTATTTCCTGTCTGCCCCCTCC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	10	r	103534199	103567774	16	99.5	Perfect prediction

Features of the protein sequence

Description

Length: 917 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O60502	100.0	Bifunctional pr...	Homo sapiens
XP_534996	99.2	similar to meni...	Canis lupus fam...
XP_001499585	99.2	meningioma expr...	Equus caballus
XP_001927682	98.9	meningioma expr...	Sus scrofa
Q8VIJ5	97.4	Bifunctional pr...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR011496	63	380	PF07555	Hyaluronidase eukaryotic/prokaryotic

Expression profile

Description

RT-PCR

Experimental conditions

Primer_f	CATGAAGCTGGCAGATAGTCG
Primer_r	ACAATGCTTTAGGGCTCTCTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 10

Experimental conditions

Panel name	GeneBridge 4
Primer_f	CATGAAGCTGGCAGATAGTCG
Primer_r	ACAATGCTTTAGGGCTCTCTC
PCR product length	221 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp