Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00603 |
---|---|
Accession No | AB014580 |
Description | phosphatase and actin regulator 2, transcript variant 3 |
Clone name | hk02746 |
Vector information | |
cDNA sequence | DNA sequence (4318 bp) Predicted protein sequence (635 aa) |
HaloTag ORF Clone |
FHC00603
|
Flexi ORF Clone | FXC00603 |
Source | Human adult brain |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR004018 | 61 | 86 | PF02755 | RPEL repeat |
IPR004018 | 478 | 503 | PF02755 | RPEL repeat | |
IPR004018 | 516 | 541 | PF02755 | RPEL repeat | |
IPR004018 | 554 | 579 | PF02755 | RPEL repeat | |
HMMSmart | IPR004018 | 61 | 86 | SM00707 | RPEL repeat |
IPR004018 | 478 | 503 | SM00707 | RPEL repeat | |
IPR004018 | 516 | 541 | SM00707 | RPEL repeat | |
IPR004018 | 554 | 579 | SM00707 | RPEL repeat | |
ProfileScan | IPR004018 | 61 | 86 | PS51073 | RPEL repeat |
IPR004018 | 478 | 503 | PS51073 | RPEL repeat | |
IPR004018 | 516 | 541 | PS51073 | RPEL repeat | |
IPR004018 | 554 | 579 | PS51073 | RPEL repeat |
RT-PCR |
---|
RT-PCR-ELISA |
Primer_f | CCTAGAGTCTGTTGTCATTTC |
---|---|
Primer_r | TATGGCTGGATTGAAACACTG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CCTAGAGTCTGTTGTCATTTC |
Primer_r | TATGGCTGGATTGAAACACTG |
PCR product length | 130 bp |
PCR conditions | 95 °C15 sec62 °C60 sec30 cycles |