KIAA0709

Product ID	ORK01673
Accession No	AB014609
Description	mannose receptor, C type 2
Clone name	ah06501
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5927 bp) Predicted protein sequence (1484 aa)
HaloTag ORF Clone	FHC01673
Flexi ORF Clone	FXC01673
Source	Human brain (amygdala)
Rouge ID	mKIAA0709 by Kazusa Mouse cDNA Project
Note	We replaced hh01151, former representative clones for KIAA0709 with ah06501. (2004/1/10)

Length: 5927 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1085 bp
Genome contig ID	gi51511734f_57958494
PolyA signal sequence (None)	+--------+--------+----*----+---- GTAGTTGATTTTTTAAATGTGCCATTATTGTTTTT
Flanking genome sequence (166137 - 166186)	----+--------+--------+--------+--------+----* AAAAAAAAAGGAAAAAAGAAAAGCAAACAAATAAAACACCTTTAAGAGGC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	f	58058494	58124629	30	99.9	Perfect prediction

Length: 1484 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9UBG0	100.0	C-type mannose ...	Homo sapiens
AAD30280	99.9	endocytic recep...	Homo sapiens
NP_006030	99.9	mannose recepto...	Homo sapiens
XP_511600	99.7	mannose recepto...	Pan troglodytes
XP_001116053	98.9	similar to mann...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D14664	4.9e-08	24.2	KIAA0022

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000562	163	234	PD000995	Type II fibronectin
FPrintScan	IPR000562	189	198	PR00013	Type II fibronectin
	IPR000562	200	212	PR00013	Type II fibronectin
	IPR000562	217	232	PR00013	Type II fibronectin
	IPR002353	386	398	PR00356	Type II antifreeze protein
	IPR002353	398	415	PR00356	Type II antifreeze protein
	IPR002353	416	433	PR00356	Type II antifreeze protein
	IPR002353	446	462	PR00356	Type II antifreeze protein
	IPR002353	496	509	PR00356	Type II antifreeze protein
HMMPfam	IPR000772	51	126	PF00652	Ricin B lectin
	IPR000562	192	233	PF00040	Type II fibronectin
	IPR001304	260	366	PF00059	C-type lectin
	IPR001304	404	511	PF00059	C-type lectin
	IPR001304	543	651	PF00059	C-type lectin
	IPR001304	698	815	PF00059	C-type lectin
	IPR001304	847	957	PF00059	C-type lectin
	IPR001304	998	1114	PF00059	C-type lectin
	IPR001304	1147	1250	PF00059	C-type lectin
	IPR001304	1295	1361	PF00059	C-type lectin
HMMSmart	IPR000772	46	166	SM00458	Ricin B lectin
	IPR000562	185	233	SM00059	Type II fibronectin
	IPR001304	240	365	SM00034	C-type lectin
	IPR001304	387	510	SM00034	C-type lectin
	IPR001304	526	650	SM00034	C-type lectin
	IPR001304	674	814	SM00034	C-type lectin
	IPR001304	830	956	SM00034	C-type lectin
	IPR001304	977	1113	SM00034	C-type lectin
	IPR001304	1130	1249	SM00034	C-type lectin
	IPR001304	1266	1399	SM00034	C-type lectin
ProfileScan	IPR000772	59	126	PS50231	Ricin B lectin
	IPR000562	187	235	PS51092	Type II fibronectin
	IPR001304	249	365	PS50041	C-type lectin
	IPR001304	394	510	PS50041	C-type lectin
	IPR001304	533	640	PS50041	C-type lectin
	IPR001304	683	814	PS50041	C-type lectin
	IPR001304	837	956	PS50041	C-type lectin
	IPR001304	984	1106	PS50041	C-type lectin
	IPR001304	1137	1243	PS50041	C-type lectin
	IPR001304	1278	1389	PS50041	C-type lectin
ScanRegExp	IPR000562	192	233	PS00023	Type II fibronectin
	IPR001304	340	364	PS00615	C-type lectin
	IPR001304	486	509	PS00615	C-type lectin
	IPR001304	932	955	PS00615	C-type lectin
	IPR002345	1224	1237	PS00213	Lipocalin

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	1417	PAALVVVLMAVLLLLALLTAALI	1439	PRIMARY	23

Primer_f	ACCGCAGCCCTCATCCTTTAC
Primer_r	TGTTCTTCTCAGTGGCCTCGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TGGGCCGCATACTTTGTCCTG
Primer_r	TCCCTAACATCTCCAGCTCCT
PCR product length	203 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles