Order Kazusa clone(s) from : ![]() |
Product ID | ORK00368 |
---|---|
Accession No | D14664 |
Description | CD302 molecule, transcript variant 1 |
Clone name | ha00480 |
Vector information | |
cDNA sequence | DNA sequence (3694 bp) Predicted protein sequence (231 aa) |
HaloTag ORF Clone |
FHC00368
![]() |
Flexi ORF Clone | FXC00368 |
Source | Myeloblast cell line (KG-1) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 2997 bp |
---|---|
Genome contig ID | gi89161199r_160233610 |
PolyA signal sequence (AATAAA,-24) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 2 | r | 160333610 | 160362953 | 6 | 99.1 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001304 | 44 | 154 | PF00059 | C-type lectin |
HMMSmart | IPR001304 | 23 | 153 | SM00034 | C-type lectin |
ProfileScan | IPR001304 | 31 | 143 | PS50041 | C-type lectin |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 2 | RAALPALLLPLLGLAAAAVADCP | 24 | PRIMARY | 23 | 2 | 168 | ILISALVIASTVILTVLGAIIWF | 190 | PRIMARY | 23 |
---|
Panel name | Genebridge 4 |
---|---|
Primer_f | CAGGCAGGCTTGTTTACTAC |
Primer_r | GCTTTCATTGGTTATCAGTT |
PCR product length | 201 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |