Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00368 |
---|---|
Accession No | D14664 |
Description | CD302 molecule, transcript variant 1 |
Clone name | ha00480 |
Vector information | |
cDNA sequence | DNA sequence (3694 bp) Predicted protein sequence (231 aa) |
HaloTag ORF Clone |
FHC00368
|
Flexi ORF Clone | FXC00368 |
Source | Myeloblast cell line (KG-1) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 2997 bp |
---|---|
Genome contig ID | gi89161199r_160233610 |
PolyA signal sequence (AATAAA,-24) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 2 | r | 160333610 | 160362953 | 6 | 99.1 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001304 | 44 | 154 | PF00059 | C-type lectin |
HMMSmart | IPR001304 | 23 | 153 | SM00034 | C-type lectin |
ProfileScan | IPR001304 | 31 | 143 | PS50041 | C-type lectin |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 2 | RAALPALLLPLLGLAAAAVADCP | 24 | PRIMARY | 23 | 2 | 168 | ILISALVIASTVILTVLGAIIWF | 190 | PRIMARY | 23 |
---|
Panel name | Genebridge 4 |
---|---|
Primer_f | CAGGCAGGCTTGTTTACTAC |
Primer_r | GCTTTCATTGGTTATCAGTT |
PCR product length | 201 bp |
PCR conditions | 95 °C15 sec58 °C60 sec30 cycles |