KIAA0712

Product ID	ORK00610
Accession No	AB018255
Description	Rho GTPase activating protein 32, transcript variant 2
Clone name	hg04169
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6477 bp) Predicted protein sequence (1770 aa)
HaloTag ORF Clone	FHC00610
Flexi ORF Clone	FXC00610
Source	Human adult brain
Rouge ID	mKIAA0712 by Kazusa Mouse cDNA Project

Length: 6477 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	960 bp
Genome contig ID	gi51511727r_128243052
PolyA signal sequence (None)	+--------+--------+----*----+---- CATTGGTTTTCCTAAATTATCAACTTTCTTTCATT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAAAGCCCAGCATGGTTTGACTGGATAGACAC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	11	r	128343052	128399219	13	100.0	Perfect prediction

Length: 1770 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW67738	100.0	Rho GTPase-acti...	Homo sapiens
A7KAX9	100.0	Rho/Cdc42/Rac G...	Homo sapiens
AAO43677	100.0	rac GTPase acti...	Homo sapiens
XP_546401	87.5	similar to Rho ...	Canis lupus fam...
XP_001056872	86.6	similar to Rho ...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB033030	3.2e-31	28.6	KIAA1204
AB014572	3.7e-07	24.2	KIAA0672
AB014521	1.5e-06	27.0	KIAA0621
D29642	1.2e-05	26.1	KIAA0053
AB040934	1.4e-05	30.0	KIAA1501

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000198	69	222	PF00620	RhoGAP
HMMSmart	IPR000198	66	247	SM00324	RhoGAP
ProfileScan	IPR000198	55	250	PS50238	RhoGAP

Primer_f	TGTGTTCAGTTAGAGTCGTGG
Primer_r	CTGAGTCTAAGTGGTCTGGTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TGTGTTCAGTTAGAGTCGTGG
Primer_r	CTGAGTCTAAGTGGTCTGGTG
PCR product length	146 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles