KIAA1501

Product ID	ORK04155
Accession No	AB040934
Description	Rho GTPase activating protein 23
Clone name	hh12863
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (2436 bp) Predicted protein sequence (735 aa)
Source	Human adult brain
Rouge ID	mKIAA1501 by Kazusa Mouse cDNA Project

Length: 2436 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	228 bp
Genome contig ID	gi51511734f_33776678
PolyA signal sequence (None)	+--------+--------+----*----+---- GGGGGCCACAGCGCCGGGGACTCAGGAGCGGCCGC
Flanking genome sequence (143222 - 143271)	----+--------+--------+--------+--------+----* AGGGGCCGCTGCCTGGCGCCGTCGCCCCCGAGGCCCCCGGACGCCTCAGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	f	33876678	33919898	19	99.9	Perfect prediction

Length: 735 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW60514	100.0	hCG2007242, iso...	Homo sapiens
EAW60513	99.7	hCG2007242, iso...	Homo sapiens
XP_001716658	100.0	similar to Rho ...	Homo sapiens
XP_290799	100.0	Rho GTPase acti...	Homo sapiens
Q9P227	100.0	Rho GTPase-acti...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037845	1.5e-48	48.6	KIAA1424
AB037725	1.4e-11	33.0	KIAA1304
AB051509	1.4e-11	28.1	KIAA1722
AB007871	4.5e-11	29.7	KIAA0411
AB007925	6e-10	32.1	KIAA0456

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001849	280	399	PF00169	Pleckstrin-like
HMMPfam	IPR000198	511	664	PF00620	RhoGAP
HMMSmart	IPR001849	280	401	SM00233	Pleckstrin-like
HMMSmart	IPR000198	508	685	SM00324	RhoGAP
ProfileScan	IPR001849	279	399	PS50003	Pleckstrin-like
ProfileScan	IPR000198	496	688	PS50238	RhoGAP

Primer_f	CGAAGACTCTCTGGCTTCCAT
Primer_r	CAGTCCTGCGAGTAATGGCGT
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CGGAGCTACAGCCCATCATTC
Primer_r	CCAGGTTGAAGGTAGGCAGCC
PCR product length	97 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles