Order Kazusa clone(s) from : ![]() |
Product ID | ORK06987 |
---|---|
Accession No | AB037725 |
Description | SLIT-ROBO Rho GTPase activating protein 1 |
Clone name | fh04032 |
Vector information | |
cDNA sequence | DNA sequence (5633 bp) Predicted protein sequence (1051 aa) |
Source | Human fetal brain |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1097 bp |
---|---|
Genome contig ID | gi89161190f_62562572 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (261257 - 261306) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 12 | f | 62662572 | 62823827 | 21 | 99.4 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR001452 | 714 | 763 | PD000066 | Src homology-3 |
FPrintScan | IPR001452 | 726 | 741 | PR00452 | Src homology-3 |
IPR001452 | 743 | 752 | PR00452 | Src homology-3 | |
IPR001452 | 754 | 766 | PR00452 | Src homology-3 | |
HMMPfam | IPR001060 | 11 | 110 | PF00611 | Cdc15/Fes/CIP4 |
IPR000198 | 486 | 638 | PF00620 | RhoGAP | |
IPR001452 | 712 | 766 | PF00018 | Src homology-3 | |
HMMSmart | IPR001060 | 11 | 110 | SM00055 | Cdc15/Fes/CIP4 |
IPR000198 | 483 | 657 | SM00324 | RhoGAP | |
IPR001452 | 712 | 767 | SM00326 | Src homology-3 | |
ProfileScan | IPR001060 | 11 | 76 | PS50133 | Cdc15/Fes/CIP4 |
IPR000198 | 470 | 660 | PS50238 | RhoGAP | |
IPR001452 | 709 | 768 | PS50002 | Src homology-3 |
![]() |
Primer_f | ACTTGCAATTGTCTCCATGGG |
---|---|
Primer_r | TTCAAGCAGTAACAGCAGAGG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |