KIAA1304

Product ID	ORK06987
Accession No	AB037725
Description	SLIT-ROBO Rho GTPase activating protein 1
Clone name	fh04032
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5633 bp) Predicted protein sequence (1051 aa)
Source	Human fetal brain

Length: 5633 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1097 bp
Genome contig ID	gi89161190f_62562572
PolyA signal sequence (None)	+--------+--------+----*----+---- CAGCCTGGGCAGCATAGTGTGAGACCCTGTCTCTT
Flanking genome sequence (261257 - 261306)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAATGCTACAAAGTCCTGATGATCCTAAATTTGAAATCC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	12	f	62662572	62823827	21	99.4	Perfect prediction

Length: 1051 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001164248	99.8	SLIT-ROBO Rho G...	Pan troglodytes
XP_001164049	99.0	SLIT-ROBO Rho G...	Pan troglodytes
XP_001116821	98.9	similar to SLIT...	Macaca mulatta
EAW97122	100.0	SLIT-ROBO Rho G...	Homo sapiens
Q91Z69	97.9	SLIT-ROBO Rho G...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB007871	4e-148	68.9	KIAA0411
AB007925	3.1e-129	68.0	KIAA0456
AB032982	7e-52	76.8	KIAA1156
D50921	1.1e-40	46.1	KIAA0131
AB040934	5.8e-09	33.0	KIAA1501

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001452	714	763	PD000066	Src homology-3
FPrintScan	IPR001452	726	741	PR00452	Src homology-3
	IPR001452	743	752	PR00452	Src homology-3
	IPR001452	754	766	PR00452	Src homology-3
HMMPfam	IPR001060	11	110	PF00611	Cdc15/Fes/CIP4
	IPR000198	486	638	PF00620	RhoGAP
	IPR001452	712	766	PF00018	Src homology-3
HMMSmart	IPR001060	11	110	SM00055	Cdc15/Fes/CIP4
	IPR000198	483	657	SM00324	RhoGAP
	IPR001452	712	767	SM00326	Src homology-3
ProfileScan	IPR001060	11	76	PS50133	Cdc15/Fes/CIP4
	IPR000198	470	660	PS50238	RhoGAP
	IPR001452	709	768	PS50002	Src homology-3

Primer_f	ACTTGCAATTGTCTCCATGGG
Primer_r	TTCAAGCAGTAACAGCAGAGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-