KIAA0411

Product ID	ORK05598
Accession No	AB007871
Description	SLIT-ROBO Rho GTPase activating protein 3
Clone name	hg02120
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6213 bp) Predicted protein sequence (1061 aa)
Source	Human adult brain
Rouge ID	mKIAA0411 by Kazusa Mouse cDNA Project
Note	We replaced hg02884, former representative clones for KIAA0411 with hg02120. (2002/5/10)

Length: 6213 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3027 bp
Genome contig ID	gi89161205r_8899176
PolyA signal sequence (ATTAAA,-20)	+--------+--------+----*----+---- TTTAAAAAGGCTACAATTAAATTTTAGCCAATGCC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACTCACCAAATCTTTGCACCTAGTAGATAGATCAATGTAAAAACAAATAC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	r	8999176	9141603	21	99.4	Terminal No-hit

Length: 1061 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAN57784	100.0	WAVE-associated...	Homo sapiens
XP_590495	99.5	similar to SLIT...	Bos taurus
XP_001495819	99.4	SLIT-ROBO Rho G...	Equus caballus
XP_001097317	99.0	similar to SLIT...	Macaca mulatta
EAW63950	100.0	SLIT-ROBO Rho G...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037725	5.7e-166	68.9	KIAA1304
AB007925	7.1e-117	59.5	KIAA0456
AB032982	1.7e-75	98.3	KIAA1156
D50921	4e-35	46.4	KIAA0131
AB040934	6.8e-10	29.7	KIAA1501

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001452	711	760	PD000066	Src homology-3
FPrintScan	IPR001452	723	738	PR00452	Src homology-3
	IPR001452	740	749	PR00452	Src homology-3
	IPR001452	751	763	PR00452	Src homology-3
HMMPfam	IPR001060	8	106	PF00611	Cdc15/Fes/CIP4
	IPR000198	482	635	PF00620	RhoGAP
	IPR001452	709	763	PF00018	Src homology-3
HMMSmart	IPR001060	8	106	SM00055	Cdc15/Fes/CIP4
	IPR000198	479	653	SM00324	RhoGAP
	IPR001452	709	764	SM00326	Src homology-3
ProfileScan	IPR001060	8	73	PS50133	Cdc15/Fes/CIP4
	IPR000198	468	656	PS50238	RhoGAP
	IPR001452	706	765	PS50002	Src homology-3

Primer_f	TGTAGTCGAGAGCTGCATCCG
Primer_r	TGACTTCCACCTGAGATCCTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TGTAGTCGAGAGCTGCATCCG
Primer_r	TGACTTCCACCTGAGATCCTG
PCR product length	148 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles