Order Kazusa clone(s) from : ![]() |
Product ID | ORK06988 |
---|---|
Accession No | AB032982 |
Description | SLIT-ROBO Rho GTPase activating protein 3 |
Clone name | hh05667 |
Vector information | |
cDNA sequence | DNA sequence (5677 bp) Predicted protein sequence (348 aa) |
Source | Human adult brain |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 4628 bp |
---|---|
Genome contig ID | gi89161205r_8950581 |
PolyA signal sequence (AAGAAA,-10) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (99534 - 99485) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 3 | r | 9050115 | 9097971 | 9 | 99.2 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
Primer_f | AGAGATGGAAGGCTTAGGCTG |
---|---|
Primer_r | ATCTCTGACAAGGAAACGTAG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TCTCTTCCCACCTGCTACACC |
Primer_r | AATCTGAGCCTGGCCCAAAGC |
PCR product length | 102 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |