KIAA1156

Product ID	ORK06988
Accession No	AB032982
Description	SLIT-ROBO Rho GTPase activating protein 3
Clone name	hh05667
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5677 bp) Predicted protein sequence (348 aa)
Source	Human adult brain

Length: 5677 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	4628 bp
Genome contig ID	gi89161205r_8950581
PolyA signal sequence (AAGAAA,-10)	+--------+--------+----*----+---- GGTGACAGGGCAAGACTCCGTCTCAAAGAAAAAGG
Flanking genome sequence (99534 - 99485)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAGAAAGAAAAGAAAGTGTACTTGACTAAAGAGCAGGA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	r	9050115	9097971	9	99.2	Perfect prediction

Length: 348 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW63950	7.2e-128	98.3	SLIT-ROBO Rho G...	Homo sapiens
XP_590495	7.8e-128	98.3	similar to SLIT...	Bos taurus
XP_001495819	7.8e-128	98.3	SLIT-ROBO Rho G...	Equus caballus
AAN57784	7.8e-128	98.3	WAVE-associated...	Homo sapiens
XP_869609	7.9e-128	98.3	similar to SLIT...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB007871	6e-112	98.3	KIAA0411
AB037725	1.1e-86	76.8	KIAA1304
AB007925	8.3e-68	68.4	KIAA0456
D50921	3.3e-50	47.5	KIAA0131
AB018312	0.00027	26.5	KIAA0769

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Primer_f	AGAGATGGAAGGCTTAGGCTG
Primer_r	ATCTCTGACAAGGAAACGTAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TCTCTTCCCACCTGCTACACC
Primer_r	AATCTGAGCCTGGCCCAAAGC
PCR product length	102 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles