Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00025 |
---|---|
Accession No | D50921 |
Description | Rho GTPase activating protein 4, transcript variant 2 |
Clone name | ha01235 |
Vector information | |
cDNA sequence | DNA sequence (3180 bp) Predicted protein sequence (942 aa) |
HaloTag ORF Clone |
FHC00025
|
Flexi ORF Clone | FXC00025 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0131
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 350 bp |
---|---|
Genome contig ID | gi89161218r_152726027 |
PolyA signal sequence (CATAAA,-24) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR001452 | 747 | 797 | PD000066 | Src homology-3 |
FPrintScan | IPR001452 | 759 | 774 | PR00452 | Src homology-3 |
IPR001452 | 776 | 785 | PR00452 | Src homology-3 | |
IPR001452 | 787 | 799 | PR00452 | Src homology-3 | |
HMMPfam | IPR001060 | 18 | 120 | PF00611 | Cdc15/Fes/CIP4 |
IPR000198 | 517 | 670 | PF00620 | RhoGAP | |
IPR001452 | 745 | 799 | PF00018 | Src homology-3 | |
HMMSmart | IPR001060 | 18 | 120 | SM00055 | Cdc15/Fes/CIP4 |
IPR000198 | 514 | 688 | SM00324 | RhoGAP | |
IPR001452 | 745 | 800 | SM00326 | Src homology-3 | |
ProfileScan | IPR001060 | 11 | 84 | PS50133 | Cdc15/Fes/CIP4 |
IPR000198 | 503 | 691 | PS50238 | RhoGAP | |
IPR001452 | 742 | 801 | PS50002 | Src homology-3 |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 619 | RLPAPVLVVLRYLFTFLNHLAQY | 641 | PRIMARY | 23 | 2 | 649 | PYNLAVCFGPTLLPVPAGQD | 668 | SECONDARY | 20 |
---|
Panel name | Genebridge 4 |
---|---|
Primer_f | TAGACACGACCCCCAAGCCAC |
Primer_r | CTGGACAGGGCTGGAGAGAAG |
PCR product length | 117 bp |
PCR conditions | 95 °C15 sec68 °C60 sec30 cycles |