KIAA1391

Product ID	ORK00822
Accession No	AB037812
Description	Rho GTPase activating protein 20, transcript variant 1
Clone name	hh12985
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5901 bp) Predicted protein sequence (1194 aa)
HaloTag ORF Clone	FHC00822
Flexi ORF Clone	FXC00822
Source	Human adult brain
Rouge ID	mKIAA1391 by Kazusa Mouse cDNA Project

Length: 5901 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2315 bp
Genome contig ID	gi51511727r_109852988
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- CCATGCTGTCTGTTAAATAAAATGCCATTCTGCAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATTAACCATCCCACCAGAGCAATATTGCCCTTTGTAGAATTGTTCTAGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	11	r	109952988	110088174	15	99.3	Perfect prediction

Length: 1194 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9P2F6	100.0	Rho GTPase-acti...	Homo sapiens
AAS45469	100.0	RhoGTPase regul...	Homo sapiens
AAS45470	100.0	RhoGTPase regul...	Homo sapiens
AAS45467	100.0	RhoGTPase regul...	Homo sapiens
XP_522177	99.3	Rho GTPase acti...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D50921	3.1e-10	27.0	KIAA0131
AB007871	4.1e-06	27.9	KIAA0411
AB014572	4.9e-06	26.3	KIAA0672
AB037725	9.2e-06	28.2	KIAA1304
AB007925	2.8e-05	22.3	KIAA0456

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000159	197	286	PF00788	Ras-association
HMMPfam	IPR000198	380	530	PF00620	RhoGAP
HMMSmart	IPR001849	89	190	SM00233	Pleckstrin-like
HMMSmart	IPR000198	377	551	SM00324	RhoGAP
ProfileScan	IPR000159	197	298	PS50200	Ras-association
ProfileScan	IPR000198	368	554	PS50238	RhoGAP

Primer_f	ACAGCGTTCACTCTCAATATG
Primer_r	TCTGGCTGACTGTAATCTAAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-