Gene/Protein Characteristic Table for KIAA1391
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00822
Accession No AB037812
Description Rho GTPase activating protein 20, transcript variant 1
Clone name hh12985
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (5901 bp)
Predicted protein sequence (1194 aa)
Flexi ORF Clone FXC00822
Source Human adult brain
Rouge ID mKIAA1391 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 5901 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Integrity of 3' end
Length of 3'UTR 2315 bp
Genome contig ID gi51511727r_109852988
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
CCATGCTGTCTGTTAAATAAAATGCCATTCTGCAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AATTAACCATCCCACCAGAGCAATATTGCCCTTTGTAGAATTGTTCTAGT

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 11 r 109952988 110088174 15 99.3 Perfect prediction
Features of the protein sequence
Description

Length: 1194 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q9P2F6 0 100.0 Rho GTPase-acti...
Homo sapiens
AAS45469 0 100.0 RhoGTPase regul...
Homo sapiens
AAS45470 0 100.0 RhoGTPase regul...
Homo sapiens
AAS45467 0 100.0 RhoGTPase regul...
Homo sapiens
XP_522177 0 99.3 Rho GTPase acti...
Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
D50921 3.1e-10 27.0 KIAA0131
AB007871 4.1e-06 27.9 KIAA0411
AB014572 4.9e-06 26.3 KIAA0672
AB037725 9.2e-06 28.2 KIAA1304
AB007925 2.8e-05 22.3 KIAA0456
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000159 197 286 PF00788 Ras-association
IPR000198 380 530 PF00620 RhoGAP
HMMSmart IPR001849 89 190 SM00233 Pleckstrin-like
IPR000198 377 551 SM00324 RhoGAP
ProfileScan IPR000159 197 298 PS50200 Ras-association
IPR000198 368 554 PS50238 RhoGAP
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f ACAGCGTTCACTCTCAATATG
Primer_r TCTGGCTGACTGTAATCTAAG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 11
Experimental conditions
Panel name unigene
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp