Order Kazusa clone(s) from : ![]() |
Product ID | ORK00200 |
---|---|
Accession No | AB033030 |
Description | Rho GTPase activating protein 31 |
Clone name | fg03451 |
Vector information | |
cDNA sequence | DNA sequence (6321 bp) Predicted protein sequence (1445 aa) |
HaloTag ORF Clone |
FHC00200
![]() |
Flexi ORF Clone | FXC00200 |
Source | Human fetal brain |
Rouge ID |
mKIAA1204
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1454 bp |
---|---|
Genome contig ID | gi89161205f_120395919 |
PolyA signal sequence (AATAAA,-25) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (223337 - 223386) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 3 | f | 120495910 | 120619254 | 12 | 99.3 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
Primer_f | CATACAAAGGCAGAACTACAC |
---|---|
Primer_r | CAGTGAGTGGTTGTGATGGCC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |