Gene/Protein Characteristic Table for KIAA0718
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK04763
Accession No AB018261
Description diacylglycerol kinase, beta 90kDa
Clone name hk01073
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (3742 bp)
Predicted protein sequence (742 aa)
Source Human adult brain
Rouge ID mKIAA0718 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 3742 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Features of the protein sequence
Description

Length: 742 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q9Y6T7 0 100.0 Diacylglycerol ...
Homo sapiens
XP_518977 0 99.9 diacylglycerol ...
Pan troglodytes
XP_001148960 0 99.9 diacylglycerol ...
Pan troglodytes
XP_001105384 0 99.2 diacylglycerol ...
Macaca mulatta
XP_539445 0 98.5 similar to Diac...
Canis lupus fam...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
D63479 3.9e-19 36.7 KIAA0145
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR002048 92 156 PD000012 Calcium-binding EF-hand
IPR001206 368 471 PD005043 Diacylglycerol kinase
IPR000756 677 719 PD002939 Diacylglycerol kinase accessory region
FPrintScan IPR002219 180 194 PR00008 Protein kinase C
IPR002219 196 205 PR00008 Protein kinase C
IPR002219 209 220 PR00008 Protein kinase C
IPR002219 221 233 PR00008 Protein kinase C
HMMPfam IPR002048 91 119 PF00036 Calcium-binding EF-hand
IPR002048 136 164 PF00036 Calcium-binding EF-hand
IPR002219 183 235 PF00130 Protein kinase C
IPR002219 248 299 PF00130 Protein kinase C
IPR001206 376 500 PF00781 Diacylglycerol kinase
IPR000756 520 700 PF00609 Diacylglycerol kinase accessory region
HMMSmart IPR002048 91 119 SM00054 Calcium-binding EF-hand
IPR002048 136 164 SM00054 Calcium-binding EF-hand
IPR002219 181 232 SM00109 Protein kinase C
IPR002219 248 296 SM00109 Protein kinase C
IPR001206 376 500 SM00046 Diacylglycerol kinase
IPR000756 520 700 SM00045 Diacylglycerol kinase accessory region
ProfileScan IPR002048 87 122 PS50222 Calcium-binding EF-hand
IPR002048 132 167 PS50222 Calcium-binding EF-hand
IPR002219 182 232 PS50081 Protein kinase C
IPR002219 247 296 PS50081 Protein kinase C
ScanRegExp IPR002048 100 112 PS00018 Calcium-binding EF-hand
IPR002048 145 157 PS00018 Calcium-binding EF-hand
IPR002219 183 232 PS00479 Protein kinase C
IPR002219 247 298 PS00479 Protein kinase C
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f ATGCAATTAGCTCCCTCCTCC
Primer_r AGAGACTCCAACTATGCCATG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 7
Experimental conditions
Panel name GeneBridge 4
Primer_f ATGCAATTAGCTCCCTCCTCC
Primer_r AGAGACTCCAACTATGCCATG
PCR product length 121 bp
PCR conditions 95 °C15 sec64 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp