KIAA0145

Product ID	ORK04764
Accession No	D63479
Description	diacylglycerol kinase, delta 130kDa
Clone name	hg01767
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6238 bp) Predicted protein sequence (1198 aa)
Source	Human adult brain
Rouge ID	mKIAA0145 by Kazusa Mouse cDNA Project
Note	We replaced ha00914, former representative clones for KIAA0145 with hg01767. (2005/08/06)

Length: 6238 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2640 bp
Genome contig ID	gi89161199f_233827952
PolyA signal sequence (AATAAA,-28)	+--------+--------+----*----+---- GTGTATAAATAAAACAAGCCTGTTTTTGATCTTCC
Flanking genome sequence (217532 - 217581)	----+--------+--------+--------+--------+----* ATCGCCAGAGTCTTTGTCATCATTCCTTGTGCTTTGACATAAAGTGTTGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	f	233927951	234045482	30	99.5	Perfect prediction

Length: 1198 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q16760	100.0	Diacylglycerol ...	Homo sapiens
BAC11809	99.9	diacylglycerol ...	Homo sapiens
EAW71048	99.9	diacylglycerol ...	Homo sapiens
BAA11134	99.2	diacylglycerol ...	Homo sapiens
XP_001114920	97.5	similar to diac...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018261	3.6e-16	36.7	KIAA0718
AB028945	0.00011	24.0	KIAA1022

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001206	306	401	PD005043	Diacylglycerol kinase
BlastProDom	IPR000756	879	925	PD002939	Diacylglycerol kinase accessory region
FPrintScan	IPR002219	161	170	PR00008	Protein kinase C
	IPR002219	174	185	PR00008	Protein kinase C
	IPR002219	186	198	PR00008	Protein kinase C
HMMPfam	IPR001849	38	130	PF00169	Pleckstrin-like
	IPR002219	148	200	PF00130	Protein kinase C
	IPR002219	220	273	PF00130	Protein kinase C
	IPR001206	305	430	PF00781	Diacylglycerol kinase
	IPR000756	747	904	PF00609	Diacylglycerol kinase accessory region
	IPR011510	1126	1192	PF07647	Sterile alpha motif homology 2
HMMSmart	IPR001849	38	132	SM00233	Pleckstrin-like
	IPR002219	148	197	SM00109	Protein kinase C
	IPR002219	220	270	SM00109	Protein kinase C
	IPR001206	305	430	SM00046	Diacylglycerol kinase
	IPR000756	747	904	SM00045	Diacylglycerol kinase accessory region
	IPR001660	1126	1192	SM00454	Sterile alpha motif SAM
ProfileScan	IPR001849	37	130	PS50003	Pleckstrin-like
	IPR002219	147	197	PS50081	Protein kinase C
	IPR002219	219	270	PS50081	Protein kinase C
	IPR001660	1129	1192	PS50105	Sterile alpha motif SAM
ScanRegExp	IPR002219	148	197	PS00479	Protein kinase C
ScanRegExp	IPR002219	220	270	PS00479	Protein kinase C

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	TGAGGAAGGAATGAACATGAG
Primer_r	AGCACTCAGGTATGGACTATG
PCR product length	313 bp
PCR conditions	95 °C15 sec60 °C120 sec30 cycles