Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00614 |
---|---|
Accession No | AB018266 |
Description | matrin 3, transcript variant 2 |
Clone name | hk02753 |
Vector information | |
cDNA sequence | DNA sequence (3803 bp) Predicted protein sequence (853 aa) |
HaloTag ORF Clone |
FHC00614
|
Flexi ORF Clone | FXC00614 |
Source | Human adult brain |
Rouge ID |
mKIAA0723
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMSmart | IPR003604 | 294 | 328 | SM00451 | Zinc finger |
IPR000504 | 405 | 475 | SM00360 | RNA recognition motif | |
IPR000504 | 503 | 573 | SM00360 | RNA recognition motif | |
IPR003604 | 804 | 839 | SM00451 | Zinc finger | |
ProfileScan | IPR000504 | 404 | 479 | PS50102 | RNA recognition motif |
IPR000504 | 502 | 577 | PS50102 | RNA recognition motif | |
IPR000690 | 807 | 838 | PS50171 | Zinc finger | |
ScanRegExp | IPR007087 | 299 | 321 | PS00028 | Zinc finger |
RT-PCR-ELISA |
Primer_f | TTCTAATTCATGTACCTGCAC |
---|---|
Primer_r | GGTATTCACTTCAGTAACTTG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | UniGene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |