Order Kazusa clone(s) from : ![]() |
Product ID | ORK01993 |
---|---|
Accession No | AB018310 |
Description | GRAM domain containing 4 |
Clone name | aj00389 |
Vector information | |
cDNA sequence | DNA sequence (4481 bp) Predicted protein sequence (598 aa) |
HaloTag ORF Clone |
FHC01993
![]() |
Flexi ORF Clone | FXC01993 |
Source | Human brain (amygdala) |
Rouge ID |
mKIAA0767
by Kazusa Mouse cDNA Project
|
Note | We replaced hk04874, former representative clones for KIAA0767 with aj00389. (2005/08/06) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 2531 bp |
---|---|
Genome contig ID | gi89161203f_45294963 |
PolyA signal sequence (AATAAA,-24) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (159383 - 159432) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 22 | f | 45394963 | 45454344 | 19 | 99.3 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR004182 | 465 | 543 | PF02893 | GRAM |
HMMSmart | IPR004182 | 465 | 543 | SM00568 | GRAM |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 272 | PLFLFLAILRLSLNYLIARGWRI | 294 | PRIMARY | 23 | 2 | 348 | MWVQPEITQKLYVALWAAFLASC | 370 | SECONDARY | 23 | 3 | 375 | RLVGLAVGLYAGIKFFLIDFIF | 396 | SECONDARY | 22 |
---|
![]() |
Primer_f | GACAATGGCCACACCTCTCTC |
---|---|
Primer_r | AGGGACTCGAACTAAACCACC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | UniGene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |