Gene/Protein Characteristic Table for KIAA0777
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK01120
Accession No AB018320
Description sorbin and SH3 domain containing 2, transcript variant 2
Clone name hk05279
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4118 bp)
Predicted protein sequence (1171 aa)
Flexi ORF Clone FXC01120
Source Human adult brain
Rouge ID mKIAA0777 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4118 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Features of the protein sequence
Description

Length: 1171 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAG51769 0 99.6 unnamed protein...
Homo sapiens
XP_001164409 0 97.3 sorbin and SH3 ...
Pan troglodytes
XP_001164522 0 97.3 sorbin and SH3 ...
Pan troglodytes
XP_517563 0 97.2 sorbin and SH3 ...
Pan troglodytes
XP_001087352 0 96.2 similar to sorb...
Macaca mulatta
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB037717 1.5e-24 59.0 KIAA1296
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR003127 161 299 PD016158 Sorbin-like
IPR001452 939 989 PD000066 Src homology-3
IPR001452 1014 1066 PD000066 Src homology-3
IPR001452 1117 1168 PD000066 Src homology-3
FPrintScan IPR001452 937 947 PR00452 Src homology-3
IPR001452 951 966 PR00452 Src homology-3
IPR000108 989 1006 PR00499 Neutrophil cytosol factor 2
IPR000108 1027 1046 PR00499 Neutrophil cytosol factor 2
IPR001452 1056 1068 PR00452 Src homology-3
IPR000108 1117 1137 PR00499 Neutrophil cytosol factor 2
IPR000108 1137 1153 PR00499 Neutrophil cytosol factor 2
HMMPfam IPR003127 138 187 PF02208 Sorbin-like
IPR001452 937 991 PF00018 Src homology-3
IPR001452 1012 1068 PF00018 Src homology-3
IPR001452 1115 1171 PF00018 Src homology-3
HMMSmart IPR003127 138 188 SM00459 Sorbin-like
IPR001452 937 992 SM00326 Src homology-3
IPR001452 1012 1069 SM00326 Src homology-3
IPR001452 1115 1171 SM00326 Src homology-3
ProfileScan IPR003127 137 198 PS50831 Sorbin-like
IPR001452 934 993 PS50002 Src homology-3
IPR001452 1009 1070 PS50002 Src homology-3
IPR001452 1112 1171 PS50002 Src homology-3
ScanRegExp IPR007087 728 750 PS00028 Zinc finger
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f AAACTACGTCAAGAGGCTGTG
Primer_r GAAACCGTAAGGCATGACAAC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 4
Experimental conditions
Panel name UniGene
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp