Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK01120 |
---|---|
Accession No | AB018320 |
Description | sorbin and SH3 domain containing 2, transcript variant 2 |
Clone name | hk05279 |
Vector information | |
cDNA sequence | DNA sequence (4118 bp) Predicted protein sequence (1171 aa) |
HaloTag ORF Clone |
FHC01120
|
Flexi ORF Clone | FXC01120 |
Source | Human adult brain |
Rouge ID |
mKIAA0777
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR003127 | 161 | 299 | PD016158 | Sorbin-like |
IPR001452 | 939 | 989 | PD000066 | Src homology-3 | |
IPR001452 | 1014 | 1066 | PD000066 | Src homology-3 | |
IPR001452 | 1117 | 1168 | PD000066 | Src homology-3 | |
FPrintScan | IPR001452 | 937 | 947 | PR00452 | Src homology-3 |
IPR001452 | 951 | 966 | PR00452 | Src homology-3 | |
IPR000108 | 989 | 1006 | PR00499 | Neutrophil cytosol factor 2 | |
IPR000108 | 1027 | 1046 | PR00499 | Neutrophil cytosol factor 2 | |
IPR001452 | 1056 | 1068 | PR00452 | Src homology-3 | |
IPR000108 | 1117 | 1137 | PR00499 | Neutrophil cytosol factor 2 | |
IPR000108 | 1137 | 1153 | PR00499 | Neutrophil cytosol factor 2 | |
HMMPfam | IPR003127 | 138 | 187 | PF02208 | Sorbin-like |
IPR001452 | 937 | 991 | PF00018 | Src homology-3 | |
IPR001452 | 1012 | 1068 | PF00018 | Src homology-3 | |
IPR001452 | 1115 | 1171 | PF00018 | Src homology-3 | |
HMMSmart | IPR003127 | 138 | 188 | SM00459 | Sorbin-like |
IPR001452 | 937 | 992 | SM00326 | Src homology-3 | |
IPR001452 | 1012 | 1069 | SM00326 | Src homology-3 | |
IPR001452 | 1115 | 1171 | SM00326 | Src homology-3 | |
ProfileScan | IPR003127 | 137 | 198 | PS50831 | Sorbin-like |
IPR001452 | 934 | 993 | PS50002 | Src homology-3 | |
IPR001452 | 1009 | 1070 | PS50002 | Src homology-3 | |
IPR001452 | 1112 | 1171 | PS50002 | Src homology-3 | |
ScanRegExp | IPR007087 | 728 | 750 | PS00028 | Zinc finger |
RT-PCR-ELISA |
Primer_f | AAACTACGTCAAGAGGCTGTG |
---|---|
Primer_r | GAAACCGTAAGGCATGACAAC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | UniGene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |