KIAA1296

Product ID	ORK06943
Accession No	AB037717
Description	sorbin and SH3 domain containing 1
Clone name	fg03576
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5796 bp) Predicted protein sequence (815 aa)
Source	Human fetal brain
Rouge ID	mKIAA1296 by Kazusa Mouse cDNA Project

Length: 5796 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	3286 bp
Genome contig ID	gi89161187r_96961521
PolyA signal sequence (AATAAA,-27)	+--------+--------+----*----+---- TATTATTTAATAAACTTTATTCAGAATTGCGTGGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATATGTTTGTTCTGGTCATTCATTGTTTCTTTCCTCCCTTTGCCAAGCTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	10	r	97061521	97240871	25	99.3	Terminal No-hit

Length: 815 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI52464	100.0	Sorbin and SH3 ...	Homo sapiens
CAI14382	99.9	sorbin and SH3 ...	Homo sapiens
XP_001154533	99.1	sorbin and SH3 ...	Pan troglodytes
BAG62137	95.9	unnamed protein...	Homo sapiens
CAH90184	94.2	hypothetical pr...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018320	3.8e-30	59.0	KIAA0777
AB040927	0.00011	38.5	KIAA1494

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR003127	295	415	PD016158	Sorbin-like
	IPR001452	579	629	PD000066	Src homology-3
	IPR001452	653	705	PD000066	Src homology-3
	IPR001452	759	810	PD000066	Src homology-3
FPrintScan	IPR000108	494	513	PR00499	Neutrophil cytosol factor 2
	IPR001452	577	587	PR00452	Src homology-3
	IPR000108	579	599	PR00499	Neutrophil cytosol factor 2
	IPR000108	599	615	PR00499	Neutrophil cytosol factor 2
	IPR000108	615	628	PR00499	Neutrophil cytosol factor 2
	IPR001452	771	786	PR00452	Src homology-3
	IPR001452	801	813	PR00452	Src homology-3
HMMPfam	IPR003127	278	323	PF02208	Sorbin-like
	IPR001452	577	631	PF00018	Src homology-3
	IPR001452	651	707	PF00018	Src homology-3
	IPR001452	757	813	PF00018	Src homology-3
HMMSmart	IPR003127	278	324	SM00459	Sorbin-like
	IPR001452	577	632	SM00326	Src homology-3
	IPR001452	651	708	SM00326	Src homology-3
	IPR001452	757	814	SM00326	Src homology-3
ProfileScan	IPR003127	277	334	PS50831	Sorbin-like
	IPR001452	574	633	PS50002	Src homology-3
	IPR001452	648	709	PS50002	Src homology-3
	IPR001452	754	815	PS50002	Src homology-3

Primer_f	GGGTGCTTCTTGATTAGTAGG
Primer_r	ATACATAGGAAGGCGACGTGA
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-