Order Kazusa clone(s) from : ![]() |
Product ID | ORK04008 |
---|---|
Accession No | AB020629 |
Description | ATP-binding cassette, sub-family A (ABC1), member 8, transcript variant 2 |
Clone name | hh02681 |
Vector information | |
cDNA sequence | DNA sequence (5677 bp) Predicted protein sequence (1591 aa) |
HaloTag ORF Clone |
FHC04008
![]() |
Flexi ORF Clone | FXC04008 |
Source | Human adult brain |
Rouge ID |
mKIAA0822
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 793 bp |
---|---|
Genome contig ID | gi51511734r_64275028 |
PolyA signal sequence (AATAAA,-25) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 17 | r | 64375028 | 64463087 | 38 | 99.8 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR003439 | 604 | 629 | PD000006 | ABC transporter related |
IPR003439 | 1387 | 1430 | PD000006 | ABC transporter related | |
HMMPfam | IPR003439 | 519 | 661 | PF00005 | ABC transporter related |
IPR003439 | 1286 | 1464 | PF00005 | ABC transporter related | |
HMMSmart | IPR003593 | 518 | 662 | SM00382 | AAA+ ATPase |
IPR003593 | 1285 | 1465 | SM00382 | AAA+ ATPase | |
ProfileScan | IPR003439 | 490 | 685 | PS50893 | ABC transporter related |
IPR003439 | 1255 | 1488 | PS50893 | ABC transporter related |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 39 | ESLMEWLNSLLLLLCLYIYPHSH | 61 | PRIMARY | 23 | 2 | 231 | ITDLYLFSCIISFSSFIYYASV | 252 | PRIMARY | 22 | 3 | 275 | FWLSWGLLYAGFIFIMALFLALV | 297 | PRIMARY | 23 | 4 | 306 | LSGFMVVFSLFLLYGLSLVALAF | 328 | PRIMARY | 23 | 5 | 337 | SFLTGLVVFLLTVFWGCLGFTSL | 359 | PRIMARY | 23 | 6 | 367 | LEWILSLLSPFAFMLGMAQLLHL | 389 | SECONDARY | 23 | 7 | 407 | LIVATNFMLAFDTCLYLALAIYF | 429 | SECONDARY | 23 | 8 | 832 | ALLALLLILMAGFCPLLVEYTMV | 854 | PRIMARY | 23 | 9 | 985 | QDNPIGFLAYIMFWLVLTSSCPP | 1007 | SECONDARY | 23 | 10 | 1037 | FGQALVDVSLYFLVFVFIYLMSY | 1059 | PRIMARY | 23 | 11 | 1071 | IHIIQIPCAVGYSFSLIFMTYVI | 1093 | PRIMARY | 23 | 12 | 1105 | GIWSFCFYVVTVFSVAGFAFSIF | 1127 | PRIMARY | 23 | 13 | 1136 | TFLIPPATMIGCLFLSSHLLFSS | 1158 | SECONDARY | 23 | 14 | 1167 | VQPFLVFLIPFLHFIIFLFTLRC | 1189 | PRIMARY | 23 |
---|
![]() |
Primer_f | TTTCTGTAAGCCAACTGTGTG |
---|---|
Primer_r | TTCTACCTACTCAGTCATGTG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TTTCTGTAAGCCAACTGTGTG |
Primer_r | TTCTACCTACTCAGTCATGTG |
PCR product length | 153 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |