Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK04006 |
---|---|
Accession No | AB028985 |
Description | ATP-binding cassette, sub-family A (ABC1), member 2 |
Clone name | hj03579s1 |
Vector information | |
cDNA sequence | DNA sequence (6011 bp) Predicted protein sequence (1771 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA1062
by Kazusa Mouse cDNA Project
|
Note | We replaced hj03579, former representative clones for KIAA1062 with hj03579s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 695 bp |
---|---|
Genome contig ID | gi89161216r_138921507 |
PolyA signal sequence (AATAAA,-15) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 9 | r | 139021507 | 139032346 | 35 | 99.8 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR003439 | 458 | 501 | PD000006 | ABC transporter related |
IPR003439 | 1521 | 1564 | PD000006 | ABC transporter related | |
HMMPfam | IPR003439 | 353 | 533 | PF00005 | ABC transporter related |
IPR003439 | 1416 | 1597 | PF00005 | ABC transporter related | |
HMMSmart | IPR003593 | 352 | 534 | SM00382 | AAA+ ATPase |
IPR003593 | 1415 | 1600 | SM00382 | AAA+ ATPase | |
ProfileScan | IPR003439 | 326 | 557 | PS50893 | ABC transporter related |
IPR003439 | 1386 | 1621 | PS50893 | ABC transporter related | |
ScanRegExp | IPR003439 | 459 | 473 | PS00211 | ABC transporter related |
IPR002345 | 759 | 772 | PS00213 | Lipocalin | |
IPR013032 | 976 | 987 | PS00022 | EGF-like region |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 37 | FVIEHMMPLCMVISWVYSVAMTI | 59 | SECONDARY | 23 | 2 | 87 | AWFITGFVQLSISVTALTAILKY | 109 | PRIMARY | 23 | 3 | 120 | IIWLFLAVYAVATIMFCFLVSVL | 142 | PRIMARY | 23 | 4 | 148 | LASACGGIIYFLSYVPYMYVAIR | 170 | PRIMARY | 23 | 5 | 183 | KCIASLMSTTAFGLGSKYFALYE | 205 | SECONDARY | 23 | 6 | 226 | FNLLLAVTMLMVDAVVYGILTWY | 248 | PRIMARY | 23 | 7 | 1123 | LQGTDVVIAIFIIVAMSFVPASF | 1145 | PRIMARY | 23 | 8 | 1172 | WLANYVWDMLNYLVPATCCVIIL | 1194 | PRIMARY | 23 | 9 | 1209 | PAVLSLFLLYGWSITPIMYPASF | 1231 | PRIMARY | 23 | 10 | 1240 | YVFLIVINLFIGITATVATFLLQ | 1262 | PRIMARY | 23 | 11 | 1270 | LKVVNSYLKSCFLIFPNYNLGHG | 1292 | SECONDARY | 23 | 12 | 1323 | IVTRGLVAMAVEGVVGFLLTIMC | 1345 | SECONDARY | 23 |
---|
RT-PCR-ELISA |
Primer_f | CAGGGACTCAACAATGGGGAC |
---|---|
Primer_r | AAAGCAGGGCAAGGGTGTACG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CAGGGACTCAACAATGGGGAC |
Primer_r | AAAGCAGGGCAAGGGTGTACG |
PCR product length | 188 bp |
PCR conditions | 95 °C15 sec66 °C60 sec30 cycles |