Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK04007 |
---|---|
Accession No | AB067475 |
Description | ATP-binding cassette, sub-family A (ABC1), member 5 |
Clone name | fk02242 |
Vector information | |
cDNA sequence | DNA sequence (3112 bp) Predicted protein sequence (737 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA1888
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 897 bp |
---|---|
Genome contig ID | gi51511734r_64654387 |
PolyA signal sequence (AATAAA,-31) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (227358 - 227309) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 17 | r | 64754386 | 64781744 | 20 | 99.6 | Terminal No-hit |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR003439 | 528 | 570 | PD000006 | ABC transporter related |
HMMPfam | IPR003439 | 421 | 604 | PF00005 | ABC transporter related |
HMMSmart | IPR003593 | 420 | 607 | SM00382 | AAA+ ATPase |
ProfileScan | IPR003439 | 385 | 628 | PS50893 | ABC transporter related |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 62 | VFAAVFNSTMVYSLPILVNIISN | 84 | SECONDARY | 23 | 2 | 113 | KIELYFQAALLGIIVTAMPPYFA | 135 | PRIMARY | 23 | 3 | 163 | GQAVVDIPLFFIILILMLGSLLA | 185 | PRIMARY | 23 | 4 | 198 | LAVVFCLIGYVPSVILFTYIASF | 220 | PRIMARY | 23 | 5 | 232 | WSFIYSVAALACIAITEITFFMG | 254 | PRIMARY | 23 | 6 | 262 | HYAFCIIIPIYPLLGCLISFIKI | 284 | PRIMARY | 23 | 7 | 302 | LSVAVISPYLQCVLWIFLLQ | 321 | SECONDARY | 20 |
---|
RT-PCR-ELISA |
Primer_f | CAGAGACAAGTGAAGATGATG |
---|---|
Primer_r | CAAGTGCATGTGTTATTCGAC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | genbank |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |